pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4708 |
Genomic Coordinates | chr14: 65335117 - 65335183 |
Description | Homo sapiens miR-4708 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4708-5p | ||||||||||||
Sequence | 9| AGAGAUGCCGCCUUGCUCCUU |29 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | Illumina | ||||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |
---|---|
Gene Symbol | RPS19 |
Synonyms | DBA, DBA1, S19 |
Description | ribosomal protein S19 |
Transcript | NM_001022 |
Expression | |
Putative miRNA Targets on RPS19 | |
3'UTR of RPS19 (miRNA target sites are highlighted) |
>RPS19|NM_001022|3'UTR 1 AACAAACCATGCTGGGTTAATAAATTGCCTCATTCGTAAAAAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
DRVs in gene 3'UTRs | |
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Hela | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000598742.1 | 3UTR | AGGCUGGAGUGCAGUGGCGCCAUCUCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
94 hsa-miR-4708-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT095681 | RBM27 | RNA binding motif protein 27 | ![]() |
![]() |
2 | 4 | ||||||
MIRT104033 | USP42 | ubiquitin specific peptidase 42 | ![]() |
![]() |
2 | 6 | ||||||
MIRT114773 | CMPK1 | cytidine/uridine monophosphate kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT246923 | CCND1 | cyclin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT392569 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443949 | LRIT3 | leucine rich repeat, Ig-like and transmembrane domains 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446695 | PAPPA | pappalysin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447383 | VOPP1 | vesicular, overexpressed in cancer, prosurvival protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449321 | FAM120AOS | family with sequence similarity 120A opposite strand | ![]() |
![]() |
2 | 2 | ||||||
MIRT449717 | C1orf61 | chromosome 1 open reading frame 61 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449738 | TAB2 | TGF-beta activated kinase 1/MAP3K7 binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450531 | PGLS | 6-phosphogluconolactonase | ![]() |
![]() |
2 | 2 | ||||||
MIRT455650 | YARS | tyrosyl-tRNA synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT458036 | MRPL12 | mitochondrial ribosomal protein L12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463468 | ZC3HAV1L | zinc finger CCCH-type containing, antiviral 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT466677 | TAF1D | TATA-box binding protein associated factor, RNA polymerase I subunit D | ![]() |
![]() |
2 | 4 | ||||||
MIRT467789 | SLC2A14 | solute carrier family 2 member 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468167 | SGPL1 | sphingosine-1-phosphate lyase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468652 | SECISBP2L | SECIS binding protein 2 like | ![]() |
![]() |
2 | 6 | ||||||
MIRT469380 | RER1 | retention in endoplasmic reticulum sorting receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470346 | PPP2R5E | protein phosphatase 2 regulatory subunit B'epsilon | ![]() |
![]() |
2 | 2 | ||||||
MIRT472418 | NCKAP1 | NCK associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474612 | KLF3 | Kruppel like factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478703 | CSRNP2 | cysteine and serine rich nuclear protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481008 | BBC3 | BCL2 binding component 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT483098 | TFPI | tissue factor pathway inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT485113 | SHISA6 | shisa family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497533 | ZNF607 | zinc finger protein 607 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500644 | TUBB2A | tubulin beta 2A class IIa | ![]() |
![]() |
2 | 6 | ||||||
MIRT500890 | STRN | striatin | ![]() |
![]() |
2 | 4 | ||||||
MIRT501900 | MED13 | mediator complex subunit 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT506646 | MAPK1 | mitogen-activated protein kinase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512675 | ENO4 | enolase family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516977 | OR7D2 | olfactory receptor family 7 subfamily D member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528754 | RPS27 | ribosomal protein S27 | ![]() |
![]() |
2 | 6 | ||||||
MIRT539670 | ZBTB44 | zinc finger and BTB domain containing 44 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544129 | PPIL1 | peptidylprolyl isomerase like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546382 | STOX2 | storkhead box 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT562143 | IGFBP5 | insulin like growth factor binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568713 | TMEM30B | transmembrane protein 30B | ![]() |
![]() |
2 | 2 | ||||||
MIRT571029 | CENPP | centromere protein P | ![]() |
![]() |
2 | 2 | ||||||
MIRT572781 | ZNF277 | zinc finger protein 277 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573162 | SLC30A9 | solute carrier family 30 member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609126 | NUDT3 | nudix hydrolase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609284 | OAS3 | 2'-5'-oligoadenylate synthetase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613430 | GALNT6 | polypeptide N-acetylgalactosaminyltransferase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613770 | TTC38 | tetratricopeptide repeat domain 38 | ![]() |
![]() |
2 | 2 | ||||||
MIRT616645 | LRAT | lecithin retinol acyltransferase | ![]() |
![]() |
2 | 4 | ||||||
MIRT630892 | SLC25A33 | solute carrier family 25 member 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636526 | FAXC | failed axon connections homolog | ![]() |
![]() |
2 | 4 | ||||||
MIRT641394 | NUBPL | nucleotide binding protein like | ![]() |
![]() |
2 | 2 | ||||||
MIRT641412 | SCN2B | sodium voltage-gated channel beta subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642528 | CERS4 | ceramide synthase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643186 | HYPK | huntingtin interacting protein K | ![]() |
![]() |
2 | 2 | ||||||
MIRT647800 | FRMD8 | FERM domain containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652150 | TRIM71 | tripartite motif containing 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652602 | TIMM8A | translocase of inner mitochondrial membrane 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT661606 | C2orf15 | chromosome 2 open reading frame 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666339 | SKAP2 | src kinase associated phosphoprotein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670414 | ELP2 | elongator acetyltransferase complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671122 | ZNF573 | zinc finger protein 573 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671155 | ANKRD9 | ankyrin repeat domain 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671338 | FAM71F2 | family with sequence similarity 71 member F2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671869 | ZNF429 | zinc finger protein 429 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671974 | IKZF3 | IKAROS family zinc finger 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672064 | KIAA0930 | KIAA0930 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672654 | SLC25A16 | solute carrier family 25 member 16 | ![]() |
![]() |
2 | 4 | ||||||
MIRT672673 | GTF2H5 | general transcription factor IIH subunit 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672771 | UBE2V2 | ubiquitin conjugating enzyme E2 V2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672929 | LRRC2 | leucine rich repeat containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673159 | C1orf50 | chromosome 1 open reading frame 50 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673272 | RUNDC1 | RUN domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673332 | THAP1 | THAP domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673351 | SLC35F6 | solute carrier family 35 member F6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673667 | ZNF440 | zinc finger protein 440 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673904 | DCTN6 | dynactin subunit 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674096 | PLEKHA1 | pleckstrin homology domain containing A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674401 | MYCBP | MYC binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT674525 | PRR23A | proline rich 23A | ![]() |
![]() |
2 | 2 | ||||||
MIRT674793 | NPR1 | natriuretic peptide receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674833 | ADAMTS4 | ADAM metallopeptidase with thrombospondin type 1 motif 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675066 | FGD6 | FYVE, RhoGEF and PH domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675080 | CCR6 | C-C motif chemokine receptor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675126 | FSD2 | fibronectin type III and SPRY domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679401 | IL10RB | interleukin 10 receptor subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT689229 | RPS19 | ribosomal protein S19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694008 | PPIL4 | peptidylprolyl isomerase like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699671 | SFT2D2 | SFT2 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706213 | ACOT9 | acyl-CoA thioesterase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706548 | GJD2 | gap junction protein delta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707418 | RRP7A | ribosomal RNA processing 7 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT710648 | GLUL | glutamate-ammonia ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT719393 | NPCA1 | Nasopharyngeal carcinoma 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720166 | PNPO | pyridoxamine 5'-phosphate oxidase | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|