pre-miRNA Information
pre-miRNA hsa-mir-4419b   
Genomic Coordinates chr12: 128244506 - 128244573
Description Homo sapiens miR-4419b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4419b
Sequence 42| GAGGCUGAAGGAAGAUGG |59
Evidence Experimental
Experiments Illumina
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MICA
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ggUAGAAGGA---AGUCGGAg 5'
            ||: ||||   ||||||| 
Target 5' ggAUUCUCCUGCCUCAGCCUc 3'
2 - 22
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000449934.2 | 3UTR | GGGAUUCUCCUGCCUCAGCCUCCCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
390 hsa-miR-4419b Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT061343 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT072743 GLCE glucuronic acid epimerase 2 2
MIRT180549 TXNIP thioredoxin interacting protein 2 2
MIRT186147 ALG10B ALG10B, alpha-1,2-glucosyltransferase 2 2
MIRT271044 PGAM5 PGAM family member 5, mitochondrial serine/threonine protein phosphatase 2 4
MIRT334761 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 6
MIRT443279 TSPAN15 tetraspanin 15 2 2
MIRT447047 ZNF439 zinc finger protein 439 2 2
MIRT447351 KIF6 kinesin family member 6 2 2
MIRT448925 CKS1B CDC28 protein kinase regulatory subunit 1B 2 2
MIRT452899 PSD4 pleckstrin and Sec7 domain containing 4 2 2
MIRT453087 SUMF2 sulfatase modifying factor 2 2 2
MIRT454071 SLC35E3 solute carrier family 35 member E3 2 2
MIRT456216 LIX1L limb and CNS expressed 1 like 2 6
MIRT456951 LRP10 LDL receptor related protein 10 2 2
MIRT458025 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT459999 RFT1 RFT1 homolog 2 2
MIRT460046 CDCP1 CUB domain containing protein 1 2 2
MIRT460982 STK17B serine/threonine kinase 17b 2 2
MIRT464405 URM1 ubiquitin related modifier 1 2 2
MIRT466256 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 2
MIRT466536 TBXA2R thromboxane A2 receptor 2 2
MIRT470922 PLD5 phospholipase D family member 5 2 8
MIRT472835 MTMR10 myotubularin related protein 10 2 6
MIRT473352 MEMO1 mediator of cell motility 1 2 2
MIRT475504 HSP90B1 heat shock protein 90 beta family member 1 2 2
MIRT478862 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT480898 BCL9L B-cell CLL/lymphoma 9 like 2 2
MIRT482686 NXN nucleoredoxin 2 4
MIRT484128 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT486172 TLE3 transducin like enhancer of split 3 2 4
MIRT486539 CLCN7 chloride voltage-gated channel 7 2 2
MIRT486588 ZNF619 zinc finger protein 619 2 2
MIRT495475 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT495536 TXNRD2 thioredoxin reductase 2 2 2
MIRT495566 UNC5C unc-5 netrin receptor C 2 2
MIRT495719 PADI1 peptidyl arginine deiminase 1 2 2
MIRT495890 CLOCK clock circadian regulator 2 2
MIRT495932 SLC7A5P2 solute carrier family 7 member 5 pseudogene 2 2 2
MIRT496026 ZBED3 zinc finger BED-type containing 3 2 2
MIRT496216 PAX6 paired box 6 2 2
MIRT496349 VAMP1 vesicle associated membrane protein 1 2 2
MIRT496354 PPY pancreatic polypeptide 2 2
MIRT496400 ZSCAN16 zinc finger and SCAN domain containing 16 2 2
MIRT496416 PARVB parvin beta 2 2
MIRT496458 N6AMT1 N-6 adenine-specific DNA methyltransferase 1 2 2
MIRT496519 GINS2 GINS complex subunit 2 2 2
MIRT496562 SLC39A9 solute carrier family 39 member 9 2 2
MIRT498605 KRT8 keratin 8 2 2
MIRT503434 SLC25A45 solute carrier family 25 member 45 2 6
MIRT503573 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT503847 ATP13A4 ATPase 13A4 2 4
MIRT504247 LHPP phospholysine phosphohistidine inorganic pyrophosphate phosphatase 2 4
MIRT505606 SLC35F1 solute carrier family 35 member F1 2 2
MIRT507749 CERS2 ceramide synthase 2 2 4
MIRT508411 C1orf210 chromosome 1 open reading frame 210 2 6
MIRT508508 RSRC1 arginine and serine rich coiled-coil 1 2 6
MIRT508944 AK4 adenylate kinase 4 2 4
MIRT509460 ZNF587 zinc finger protein 587 2 6
MIRT509862 ZNF641 zinc finger protein 641 2 4
MIRT511397 IKZF3 IKAROS family zinc finger 3 2 6
MIRT512517 BTBD19 BTB domain containing 19 2 2
MIRT513507 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 6
MIRT514155 TMEM145 transmembrane protein 145 2 4
MIRT514486 SLPI secretory leukocyte peptidase inhibitor 2 4
MIRT514521 SHISA9 shisa family member 9 2 2
MIRT514970 KLLN killin, p53-regulated DNA replication inhibitor 2 4
MIRT515030 IRAK4 interleukin 1 receptor associated kinase 4 2 6
MIRT515963 C9orf156 tRNA methyltransferase O 2 2
MIRT516092 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 2 4
MIRT517223 PRIM1 DNA primase subunit 1 2 4
MIRT517459 PEX26 peroxisomal biogenesis factor 26 2 4
MIRT517790 EFCAB11 EF-hand calcium binding domain 11 2 2
MIRT517979 DSCR3 DSCR3 arrestin fold containing 2 2
MIRT519458 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT519599 ZNF805 zinc finger protein 805 2 2
MIRT520339 UBXN2A UBX domain protein 2A 2 2
MIRT521345 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT521571 PTPLB 3-hydroxyacyl-CoA dehydratase 2 1 1
MIRT523382 GSG2 histone H3 associated protein kinase 2 8
MIRT524106 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT524886 ARHGAP11A Rho GTPase activating protein 11A 2 4
MIRT528772 CD1D CD1d molecule 2 2
MIRT530665 TRIM56 tripartite motif containing 56 2 2
MIRT531107 PEX13 peroxisomal biogenesis factor 13 2 2
MIRT531575 ILDR1 immunoglobulin like domain containing receptor 1 2 2
MIRT535173 PLEKHB2 pleckstrin homology domain containing B2 2 4
MIRT544168 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT550582 SLC2A5 solute carrier family 2 member 5 2 2
MIRT551039 GDE1 glycerophosphodiester phosphodiesterase 1 2 4
MIRT551295 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 6
MIRT551339 MRE11A MRE11 homolog, double strand break repair nuclease 2 2
MIRT552092 SLFN12L schlafen family member 12 like 2 6
MIRT555403 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT557087 HOXB3 homeobox B3 2 2
MIRT559388 ATP11C ATPase phospholipid transporting 11C 2 2
MIRT560305 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT561028 LIN7C lin-7 homolog C, crumbs cell polarity complex component 2 2
MIRT562460 COX6B1 cytochrome c oxidase subunit 6B1 2 4
MIRT562982 PARK7 Parkinsonism associated deglycase 2 2
MIRT563548 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT564412 EMILIN2 elastin microfibril interfacer 2 2 4
MIRT569437 PCGF3 polycomb group ring finger 3 2 2
MIRT572097 EXOC8 exocyst complex component 8 2 2
MIRT575571 Cd99 CD99 antigen 2 2
MIRT575789 Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b 2 2
MIRT576975 Lmtk2 lemur tyrosine kinase 2 2 2
MIRT610864 ARSA arylsulfatase A 2 2
MIRT614061 NTPCR nucleoside-triphosphatase, cancer-related 2 2
MIRT614141 THAP1 THAP domain containing 1 2 6
MIRT615235 BROX BRO1 domain and CAAX motif containing 2 2
MIRT617429 ANP32E acidic nuclear phosphoprotein 32 family member E 2 4
MIRT618882 MBL2 mannose binding lectin 2 2 2
MIRT618984 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT619196 SLC16A4 solute carrier family 16 member 4 2 2
MIRT620323 AQP6 aquaporin 6 2 2
MIRT621960 STX7 syntaxin 7 2 2
MIRT622057 SSBP2 single stranded DNA binding protein 2 2 2
MIRT624930 FBXW2 F-box and WD repeat domain containing 2 2 2
MIRT624986 ZNF665 zinc finger protein 665 2 4
MIRT625463 ZNF681 zinc finger protein 681 2 4
MIRT625497 SMAD9 SMAD family member 9 2 2
MIRT625599 KLHL23 kelch like family member 23 2 2
MIRT625668 C2orf48 chromosome 2 open reading frame 48 2 2
MIRT625888 INADL PATJ, crumbs cell polarity complex component 2 2
MIRT626161 NFYA nuclear transcription factor Y subunit alpha 2 2
MIRT626238 ZNF749 zinc finger protein 749 2 2
MIRT626631 SLC30A6 solute carrier family 30 member 6 2 2
MIRT626994 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT627898 OLFML2A olfactomedin like 2A 2 2
MIRT627988 NDRG3 NDRG family member 3 2 2
MIRT628324 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT628549 ZNF701 zinc finger protein 701 2 2
MIRT629464 WIZ widely interspaced zinc finger motifs 2 2
MIRT630527 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 2
MIRT631487 KLHL21 kelch like family member 21 2 2
MIRT631957 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 4
MIRT632178 CCL22 C-C motif chemokine ligand 22 2 2
MIRT632282 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT632321 TMEM185B transmembrane protein 185B 2 2
MIRT632853 IGF1 insulin like growth factor 1 2 2
MIRT632862 HSPA2 heat shock protein family A (Hsp70) member 2 2 2
MIRT633322 LINC00346 long intergenic non-protein coding RNA 346 2 2
MIRT633398 FBXW8 F-box and WD repeat domain containing 8 2 2
MIRT633930 DNAH9 dynein axonemal heavy chain 9 2 2
MIRT634785 CBFA2T2 CBFA2/RUNX1 translocation partner 2 2 2
MIRT634851 ABCF1 ATP binding cassette subfamily F member 1 2 2
MIRT636370 OGFRL1 opioid growth factor receptor like 1 2 2
MIRT637219 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT637690 PPM1D protein phosphatase, Mg2+/Mn2+ dependent 1D 2 2
MIRT639196 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT639599 CD3EAP CD3e molecule associated protein 2 2
MIRT639681 PPEF2 protein phosphatase with EF-hand domain 2 2 4
MIRT640669 ARSK arylsulfatase family member K 2 2
MIRT642377 ZNF581 zinc finger protein 581 2 2
MIRT642403 ZNF556 zinc finger protein 556 2 2
MIRT645079 UQCRQ ubiquinol-cytochrome c reductase complex III subunit VII 2 2
MIRT646475 ZNF669 zinc finger protein 669 2 2
MIRT647325 RPH3AL rabphilin 3A like (without C2 domains) 2 2
MIRT647490 ZNF639 zinc finger protein 639 2 2
MIRT647989 PDE12 phosphodiesterase 12 2 2
MIRT648196 CENPN centromere protein N 2 2
MIRT649006 MRPL49 mitochondrial ribosomal protein L49 2 2
MIRT650457 ZNF141 zinc finger protein 141 2 2
MIRT650533 CCDC77 coiled-coil domain containing 77 2 2
MIRT650999 ZNF770 zinc finger protein 770 2 2
MIRT653832 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 4
MIRT655734 NRXN3 neurexin 3 2 2
MIRT657577 GRSF1 G-rich RNA sequence binding factor 1 2 2
MIRT658610 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 2
MIRT658633 ENAH ENAH, actin regulator 2 2
MIRT659820 CASP16 caspase 16, pseudogene 2 2
MIRT661142 ZNF43 zinc finger protein 43 2 2
MIRT661201 MPPE1 metallophosphoesterase 1 2 2
MIRT661436 MANSC1 MANSC domain containing 1 2 2
MIRT661498 CHMP1B charged multivesicular body protein 1B 2 2
MIRT661682 ZNF623 zinc finger protein 623 2 2
MIRT661796 NLRC3 NLR family CARD domain containing 3 2 2
MIRT661808 NUP85 nucleoporin 85 2 2
MIRT661861 ZNF766 zinc finger protein 766 2 2
MIRT661889 EXOSC6 exosome component 6 2 2
MIRT662291 SLC29A4 solute carrier family 29 member 4 2 2
MIRT662515 ANGPT4 angiopoietin 4 2 2
MIRT662682 LRRC47 leucine rich repeat containing 47 2 2
MIRT662716 C10orf111 chromosome 10 open reading frame 111 2 4
MIRT662834 LY6G5B lymphocyte antigen 6 family member G5B 2 2
MIRT662890 PCDHA6 protocadherin alpha 6 2 2
MIRT663134 ULBP3 UL16 binding protein 3 2 2
MIRT663710 ABHD17B abhydrolase domain containing 17B 2 2
MIRT663869 MUC20 mucin 20, cell surface associated 2 2
MIRT664267 NMUR1 neuromedin U receptor 1 2 2
MIRT664510 POLR3K RNA polymerase III subunit K 2 2
MIRT664659 TRIM65 tripartite motif containing 65 2 2
MIRT664849 HUS1 HUS1 checkpoint clamp component 2 2
MIRT664944 CARD6 caspase recruitment domain family member 6 2 4
MIRT665348 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 2
MIRT665514 UTP15 UTP15, small subunit processome component 2 2
MIRT665648 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT665668 TRAF1 TNF receptor associated factor 1 2 2
MIRT665692 TNPO3 transportin 3 2 2
MIRT665741 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT665850 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT665940 TBC1D19 TBC1 domain family member 19 2 4
MIRT666005 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT666172 SNX27 sorting nexin family member 27 2 4
MIRT666373 SHOX short stature homeobox 2 2
MIRT667004 PDPN podoplanin 2 4
MIRT667185 NR2F6 nuclear receptor subfamily 2 group F member 6 2 4
MIRT667603 LIPC lipase C, hepatic type 2 2
MIRT667828 IRGQ immunity related GTPase Q 2 2
MIRT667862 IPCEF1 interaction protein for cytohesin exchange factors 1 2 2
MIRT668296 FOSL2 FOS like 2, AP-1 transcription factor subunit 2 4
MIRT668463 FAM208A family with sequence similarity 208 member A 2 2
MIRT668580 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 4
MIRT669012 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT669103 CDK19 cyclin dependent kinase 19 2 2
MIRT670073 ZNF783 zinc finger family member 783 2 2
MIRT670326 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT670756 HOOK3 hook microtubule tethering protein 3 2 2
MIRT670964 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT670985 MED17 mediator complex subunit 17 2 2
MIRT671195 ZNF891 zinc finger protein 891 2 2
MIRT672423 SLC10A6 solute carrier family 10 member 6 2 2
MIRT672495 YIPF4 Yip1 domain family member 4 2 2
MIRT672537 MGAM maltase-glucoamylase 2 2
MIRT672749 ZNF585B zinc finger protein 585B 2 4
MIRT673390 ZNF124 zinc finger protein 124 2 2
MIRT673452 ZNF583 zinc finger protein 583 2 2
MIRT673917 DCTN6 dynactin subunit 6 2 2
MIRT673952 ZNF500 zinc finger protein 500 2 2
MIRT674102 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT674167 BLOC1S3 biogenesis of lysosomal organelles complex 1 subunit 3 2 2
MIRT674206 FUT2 fucosyltransferase 2 2 2
MIRT674452 PURB purine rich element binding protein B 2 4
MIRT674687 PLCE1 phospholipase C epsilon 1 2 2
MIRT674701 TMEM59 transmembrane protein 59 2 2
MIRT674800 NPR1 natriuretic peptide receptor 1 2 4
MIRT675247 MAK male germ cell associated kinase 2 2
MIRT676012 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT676374 APTX aprataxin 2 2
MIRT676834 TNFSF15 TNF superfamily member 15 2 2
MIRT678193 CRCP CGRP receptor component 2 2
MIRT678293 PTRH2 peptidyl-tRNA hydrolase 2 2 2
MIRT679532 RAB36 RAB36, member RAS oncogene family 2 2
MIRT679669 RABAC1 Rab acceptor 1 2 2
MIRT679850 GPR75 G protein-coupled receptor 75 2 2
MIRT680533 PRIM2 DNA primase subunit 2 2 2
MIRT680563 ZNF584 zinc finger protein 584 2 2
MIRT680577 PGPEP1 pyroglutamyl-peptidase I 2 2
MIRT680849 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT680888 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1 like 2 2
MIRT680940 EVC EvC ciliary complex subunit 1 2 2
MIRT680964 SLC15A1 solute carrier family 15 member 1 2 4
MIRT681017 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT681065 PAQR7 progestin and adipoQ receptor family member 7 2 2
MIRT681209 ZNF638 zinc finger protein 638 2 2
MIRT681291 RFC2 replication factor C subunit 2 2 2
MIRT681366 BRI3BP BRI3 binding protein 2 2
MIRT681517 STAT2 signal transducer and activator of transcription 2 2 2
MIRT681549 ZNF738 zinc finger protein 738 2 2
MIRT681574 ABHD15 abhydrolase domain containing 15 2 2
MIRT681597 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT681806 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT681912 SLC11A2 solute carrier family 11 member 2 2 2
MIRT681953 SLC19A3 solute carrier family 19 member 3 2 2
MIRT682037 AGXT2 alanine--glyoxylate aminotransferase 2 2 4
MIRT682111 ITGA3 integrin subunit alpha 3 2 4
MIRT682190 SLC38A7 solute carrier family 38 member 7 2 2
MIRT682247 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT682394 PHACTR4 phosphatase and actin regulator 4 2 2
MIRT682554 EXOSC2 exosome component 2 2 2
MIRT682665 CASP8 caspase 8 2 2
MIRT683283 ZNF99 zinc finger protein 99 2 2
MIRT683359 SCARF1 scavenger receptor class F member 1 2 2
MIRT683453 ACOT2 acyl-CoA thioesterase 2 2 2
MIRT683596 GSTCD glutathione S-transferase C-terminal domain containing 2 2
MIRT683661 ZNF695 zinc finger protein 695 2 2
MIRT683770 CPE carboxypeptidase E 2 2
MIRT683807 NOTO notochord homeobox 2 2
MIRT684462 MFSD4 major facilitator superfamily domain containing 4A 2 2
MIRT684525 C1orf174 chromosome 1 open reading frame 174 2 2
MIRT684985 MINOS1 mitochondrial inner membrane organizing system 1 2 2
MIRT685012 CXorf56 chromosome X open reading frame 56 2 2
MIRT685072 GEMIN4 gem nuclear organelle associated protein 4 2 2
MIRT685115 DTD2 D-tyrosyl-tRNA deacylase 2 (putative) 2 2
MIRT685477 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT685831 SLC27A1 solute carrier family 27 member 1 2 2
MIRT686032 UMPS uridine monophosphate synthetase 2 2
MIRT686559 TPM3 tropomyosin 3 2 2
MIRT687287 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT687309 OTUD7B OTU deubiquitinase 7B 2 2
MIRT688085 GLUL glutamate-ammonia ligase 2 2
MIRT688168 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT688584 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 2
MIRT688601 CYCS cytochrome c, somatic 2 2
MIRT688921 C11orf84 chromosome 11 open reading frame 84 2 2
MIRT689285 C5AR2 complement component 5a receptor 2 2 2
MIRT689622 AKAP6 A-kinase anchoring protein 6 2 2
MIRT690051 C6orf141 chromosome 6 open reading frame 141 2 2
MIRT690224 C5orf45 MRN complex interacting protein 2 2
MIRT690272 CAMLG calcium modulating ligand 2 2
MIRT690331 MRPS30 mitochondrial ribosomal protein S30 2 2
MIRT690480 ZNF33A zinc finger protein 33A 2 2
MIRT690526 ZNF566 zinc finger protein 566 2 2
MIRT690581 MICA MHC class I polypeptide-related sequence A 2 2
MIRT690675 RPF2 ribosome production factor 2 homolog 2 2
MIRT690790 ZNF589 zinc finger protein 589 2 2
MIRT690873 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 2 2
MIRT691142 HJURP Holliday junction recognition protein 2 2
MIRT691158 APOL6 apolipoprotein L6 2 2
MIRT691288 CENPM centromere protein M 2 2
MIRT691435 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT691749 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 2 2
MIRT691833 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT691885 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT691947 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT692047 PAK1IP1 PAK1 interacting protein 1 2 2
MIRT692668 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT692767 NDUFS5 NADH:ubiquinone oxidoreductase subunit S5 2 2
MIRT692859 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT693122 SCNM1 sodium channel modifier 1 2 2
MIRT693514 MOB3A MOB kinase activator 3A 2 2
MIRT693648 ACBD7 acyl-CoA binding domain containing 7 2 2
MIRT693688 MXRA7 matrix remodeling associated 7 2 2
MIRT694078 RNASEH2B ribonuclease H2 subunit B 2 2
MIRT694163 SLC36A2 solute carrier family 36 member 2 2 2
MIRT694262 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT694506 AGBL5 ATP/GTP binding protein like 5 2 2
MIRT694556 BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 2 2
MIRT694639 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT694710 CD300LG CD300 molecule like family member g 2 2
MIRT694753 LLGL1 LLGL1, scribble cell polarity complex component 2 2
MIRT694896 ZNF417 zinc finger protein 417 2 2
MIRT695158 BTD biotinidase 2 2
MIRT695275 CD209 CD209 molecule 2 2
MIRT695434 TCF23 transcription factor 23 2 2
MIRT695817 SRD5A1 steroid 5 alpha-reductase 1 2 2
MIRT696008 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT696345 SLC35D2 solute carrier family 35 member D2 2 2
MIRT696368 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT696533 C3 complement C3 2 2
MIRT696779 DHODH dihydroorotate dehydrogenase (quinone) 2 2
MIRT697075 PSMC4 proteasome 26S subunit, ATPase 4 2 2
MIRT697498 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT697630 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT697931 TXNDC16 thioredoxin domain containing 16 2 2
MIRT697966 TSPYL1 TSPY like 1 2 2
MIRT698237 TMEM216 transmembrane protein 216 2 2
MIRT698643 TES testin LIM domain protein 2 2
MIRT698661 TERF2 telomeric repeat binding factor 2 2 2
MIRT698974 SPAST spastin 2 2
MIRT699047 SOAT1 sterol O-acyltransferase 1 2 2
MIRT699193 SLX4IP SLX4 interacting protein 2 2
MIRT699586 SIKE1 suppressor of IKBKE 1 2 2
MIRT699759 SEPHS1 selenophosphate synthetase 1 2 2
MIRT700350 RAB4A RAB4A, member RAS oncogene family 2 2
MIRT700402 RAB13 RAB13, member RAS oncogene family 2 2
MIRT700418 QDPR quinoid dihydropteridine reductase 2 2
MIRT700546 PTBP2 polypyrimidine tract binding protein 2 2 2
MIRT700774 PLA2G4A phospholipase A2 group IVA 2 2
MIRT700875 PER2 period circadian clock 2 2 2
MIRT700952 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT701077 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT701172 PACS2 phosphofurin acidic cluster sorting protein 2 2 2
MIRT701479 NEK9 NIMA related kinase 9 2 2
MIRT701661 MYH9 myosin heavy chain 9 2 2
MIRT701779 MSL2 MSL complex subunit 2 2 2
MIRT702137 MAPKAPK5 mitogen-activated protein kinase-activated protein kinase 5 2 2
MIRT702494 KIAA1328 KIAA1328 2 2
MIRT703058 GTPBP10 GTP binding protein 10 2 2
MIRT703224 GOLGA3 golgin A3 2 2
MIRT703620 FBXO45 F-box protein 45 2 2
MIRT703657 FAM60A SIN3-HDAC complex associated factor 2 2
MIRT703765 FAM118A family with sequence similarity 118 member A 2 2
MIRT703832 EVI5 ecotropic viral integration site 5 2 2
MIRT703862 ERN1 endoplasmic reticulum to nucleus signaling 1 2 2
MIRT704664 CLCC1 chloride channel CLIC like 1 2 2
MIRT704812 CDC73 cell division cycle 73 2 2
MIRT705608 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT705625 AP1S3 adaptor related protein complex 1 sigma 3 subunit 2 2
MIRT705682 ANKRD40 ankyrin repeat domain 40 2 2
MIRT705813 AKNA AT-hook transcription factor 2 2
MIRT706238 SYT15 synaptotagmin 15 2 2
MIRT706567 EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 2 2
MIRT709657 DFFB DNA fragmentation factor subunit beta 2 2
MIRT710609 ZNF555 zinc finger protein 555 2 2
MIRT711717 IREB2 iron responsive element binding protein 2 2 2
MIRT714122 TMED9 transmembrane p24 trafficking protein 9 2 2
MIRT715204 FKTN fukutin 2 2
MIRT718260 ZDHHC8 zinc finger DHHC-type containing 8 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4419b Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-4419b Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-4419b Cisplatin + Decitabine resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-mir-4419b Androstenedione+Anastrozole sensitive cell line (MCF-7)

Error report submission