pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4666a |
Genomic Coordinates | chr1: 228462074 - 228462152 |
Description | Homo sapiens miR-4666a stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4666a-5p | |||||||||||||||||||||||||||
Sequence | 10| AUACAUGUCAGAUUGUAUGCC |30 | |||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | C21orf58 | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | chromosome 21 open reading frame 58 | ||||||||||||||||||||
Transcript | NM_058180 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on C21orf58 | |||||||||||||||||||||
3'UTR of C21orf58 (miRNA target sites are highlighted) |
>C21orf58|NM_058180|3'UTR 1 GTGTGAGTCACAGAGACCCTGGCCGGGGCACCCTCCACCCCCAGGCTTCCTCAGGGCTGTGGGCTGTGGCGGGACTATGG 81 AAGGGAGCAGGGAGAGACCCTGCCACCACCCGGAGTGGCTACGCGAGTGTGGACTGCAGGCTCCTCCTGGGGAAGCTGGG 161 CAGGCTCGCTTTCTGGTCACGGGGCCATTCCAGGGGGCATCCCTTGCTCCGGGTCCCCTGCAGTGAGGGGCCTGTGAACC 241 CCACCAGGGCAACAGCCCCTCCCAGGGACCCCTCCTTTCCTGTAGGGCGGCGCCGGCCCACCTGGGAGCCTCAGATCCCC 321 CTCTTCCATCACGGAGGTAAAGTTGAGGCCGTGGACGCCACCAGCCTGATGAAATAAAGATTTCATCCAGAAAGAGTTTA 401 AGAAAATCTCAGCTCAGGAGCCAGAACAGAAAAGATCAATAGCTTTAGCCACATGGAAGTGTGAACATCCTGATGGGGAA 481 AATACCACAAAGTCTAATTTAATAACTAGGGACACCTGTGTGCCACAGCTGTGGCACAGACTCCCACTAAAGAAGTAGGG 561 GTGCATGGCTCATGCCTGTAATCCCAGCACTTTAAGAGGCTGAGGCAGGAGGATCACTTGAGCTCAGGAATTCGAGACCA 641 GCCTGGGTCACATAGCAAGACCCCGTCTCTACAAAAAATAAATTTAAAAAACTAGCCAGGTGTGGTGATATGCGCCTGTT 721 ATCTCAGCAGCTCTGGGGGCTGAGGTGGGAGGATTGCTTGAGCCCAGGAGTTAGAAGCTGCAGTGAGCTCTGATGGAACC 801 ACTGCACTATAGCCTGGACCACAGAGCAGGCCCCTGTCTCAAAAAATAAAATAAAAAAGTGAAAGAAGCAAAAAAAAAAA 881 AAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Hela |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000397683.1 | 3UTR | AUUAGCCAGGUGUGGUGGCACACAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
83 hsa-miR-4666a-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT057266 | FAM35A | family with sequence similarity 35 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT059969 | PATL1 | PAT1 homolog 1, processing body mRNA decay factor | ![]() |
![]() |
2 | 6 | ||||||
MIRT079031 | TNRC6C | trinucleotide repeat containing 6C | ![]() |
![]() |
2 | 2 | ||||||
MIRT079631 | DNAJB4 | DnaJ heat shock protein family (Hsp40) member B4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT086974 | LANCL1 | LanC like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT091804 | GOLGA4 | golgin A4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT229501 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | ![]() |
![]() |
2 | 4 | ||||||
MIRT255972 | WDR17 | WD repeat domain 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT262975 | ADO | 2-aminoethanethiol dioxygenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT264774 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT334169 | CCND1 | cyclin D1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT345868 | SRSF2 | serine and arginine rich splicing factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452477 | DDX4 | DEAD-box helicase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455764 | TSPAN6 | tetraspanin 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT461627 | DCAF15 | DDB1 and CUL4 associated factor 15 | ![]() |
![]() |
2 | 4 | ||||||
MIRT465169 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT468950 | RPS14 | ribosomal protein S14 | ![]() |
![]() |
2 | 6 | ||||||
MIRT483236 | C2orf72 | chromosome 2 open reading frame 72 | ![]() |
![]() |
2 | 8 | ||||||
MIRT498544 | TMEM30B | transmembrane protein 30B | ![]() |
![]() |
2 | 2 | ||||||
MIRT500633 | TXNIP | thioredoxin interacting protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT504113 | GPR158 | G protein-coupled receptor 158 | ![]() |
![]() |
2 | 2 | ||||||
MIRT504428 | ZNF85 | zinc finger protein 85 | ![]() |
![]() |
2 | 6 | ||||||
MIRT505036 | ZNF451 | zinc finger protein 451 | ![]() |
![]() |
2 | 2 | ||||||
MIRT506526 | MRPL17 | mitochondrial ribosomal protein L17 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508773 | GSG1 | germ cell associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517297 | ELF4 | E74 like ETS transcription factor 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT519353 | OBFC1 | STN1, CST complex subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT523891 | ENPP6 | ectonucleotide pyrophosphatase/phosphodiesterase 6 | ![]() |
![]() |
2 | 6 | ||||||
MIRT527509 | ZNF134 | zinc finger protein 134 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531218 | IFNGR2 | interferon gamma receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535957 | MOGAT1 | monoacylglycerol O-acyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT537229 | GALNT7 | polypeptide N-acetylgalactosaminyltransferase 7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT537337 | FKBP5 | FK506 binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539125 | ARHGEF17 | Rho guanine nucleotide exchange factor 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539910 | ISPD | isoprenoid synthase domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT541527 | MGAT4C | MGAT4 family member C | ![]() |
![]() |
2 | 2 | ||||||
MIRT546119 | USP25 | ubiquitin specific peptidase 25 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548846 | CERCAM | cerebral endothelial cell adhesion molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT549892 | LINC00955 | long intergenic non-protein coding RNA 955 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549898 | ADH4 | alcohol dehydrogenase 4 (class II), pi polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT550763 | ENOX2 | ecto-NOX disulfide-thiol exchanger 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT553200 | UBE2A | ubiquitin conjugating enzyme E2 A | ![]() |
![]() |
2 | 2 | ||||||
MIRT553970 | SRSF10 | serine and arginine rich splicing factor 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554092 | SMU1 | DNA replication regulator and spliceosomal factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT555208 | PROX1 | prospero homeobox 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT555834 | PAX5 | paired box 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT556865 | JAZF1 | JAZF zinc finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558594 | CREBL2 | cAMP responsive element binding protein like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559690 | AGO2 | argonaute 2, RISC catalytic component | ![]() |
![]() |
2 | 4 | ||||||
MIRT563312 | ORC4 | origin recognition complex subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563585 | FAM229B | family with sequence similarity 229 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT563853 | ALYREF | Aly/REF export factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT565146 | TUBB2A | tubulin beta 2A class IIa | ![]() |
![]() |
2 | 2 | ||||||
MIRT565769 | SEPHS1 | selenophosphate synthetase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568317 | BACH1 | BTB domain and CNC homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575387 | Unc5b | unc-5 netrin receptor B | ![]() |
![]() |
2 | 4 | ||||||
MIRT607728 | BDH1 | 3-hydroxybutyrate dehydrogenase 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT612691 | PLXNA4 | plexin A4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT615916 | GDPD1 | glycerophosphodiester phosphodiesterase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629792 | P2RY1 | purinergic receptor P2Y1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632119 | FKBP9 | FK506 binding protein 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645554 | ZDHHC15 | zinc finger DHHC-type containing 15 | ![]() |
![]() |
2 | 4 | ||||||
MIRT651479 | WWC3 | WWC family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654138 | RPH3A | rabphilin 3A | ![]() |
![]() |
2 | 6 | ||||||
MIRT655191 | PHAX | phosphorylated adaptor for RNA export | ![]() |
![]() |
2 | 2 | ||||||
MIRT665543 | UNC5B | unc-5 netrin receptor B | ![]() |
![]() |
2 | 5 | ||||||
MIRT668057 | GRIK3 | glutamate ionotropic receptor kainate type subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678978 | CERS4 | ceramide synthase 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT679124 | RBM3 | RNA binding motif (RNP1, RRM) protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686776 | AZF1 | azoospermia factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT687144 | PTPN12 | protein tyrosine phosphatase, non-receptor type 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691453 | C21orf58 | chromosome 21 open reading frame 58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691469 | FAM98B | family with sequence similarity 98 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT697031 | UHRF1BP1 | UHRF1 binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT698401 | TM9SF3 | transmembrane 9 superfamily member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702056 | RNMT | RNA guanine-7 methyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT705903 | ADAM9 | ADAM metallopeptidase domain 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707491 | MMADHC | methylmalonic aciduria and homocystinuria, cblD type | ![]() |
![]() |
2 | 2 | ||||||
MIRT708080 | KLHL23 | kelch like family member 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709738 | TRIM27 | tripartite motif containing 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710056 | RWDD2A | RWD domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT710226 | KCNK1 | potassium two pore domain channel subfamily K member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712043 | STYK1 | serine/threonine/tyrosine kinase 1 | ![]() |
![]() |
2 | 2 |