pre-miRNA Information
pre-miRNA hsa-mir-4457   
Genomic Coordinates chr5: 1309310 - 1309377
Description Homo sapiens miR-4457 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4457
Sequence 43| UCACAAGGUAUUGACUGGCGUA |64
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1031676297 8 dbSNP
rs1249861366 14 dbSNP
rs115769169 17 dbSNP
rs968846507 19 dbSNP
rs540870271 20 dbSNP
rs993130937 22 dbSNP
Putative Targets

Gene Information
Gene Symbol MB21D1   
Synonyms C6orf150, cGAS, h-cGAS
Description Mab-21 domain containing 1
Transcript NM_138441   
Expression
Putative miRNA Targets on MB21D1
3'UTR of MB21D1
(miRNA target sites are highlighted)
>MB21D1|NM_138441|3'UTR
   1 GATTGTATTTTTAGAAAGATCTAAGAACTAGAGTCACCCTAAATCCTGGAGAATACAAGAAAAATTTGAAAAGGGGCCAG
  81 ACGCTGTGGCTCAC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' augCGGUCAGUUAUGGAACACu 5'
             |||||     ||  |||| 
Target 5' gggGCCAG-----ACGCTGTGg 3'
73 - 89 90.00 -11.20
2
miRNA  3' augCGGU--CAGUUAUGGAACACu 5'
             |:||   | ||| ||| | | 
Target 5' agaGTCACCCTAAAT-CCTGGAGa 3'
30 - 52 88.00 -5.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31561054 82 COSMIC
COSN14716501 101 COSMIC
COSN9806511 321 COSMIC
COSN4920451 327 COSMIC
COSN24506694 455 COSMIC
COSN9912877 670 COSMIC
COSN15606644 794 COSMIC
COSN17190048 900 COSMIC
COSN17304350 913 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1370379624 5 dbSNP
rs1455695313 6 dbSNP
rs745852660 9 dbSNP
rs1443440613 13 dbSNP
rs1397806462 25 dbSNP
rs1389565445 31 dbSNP
rs779022111 33 dbSNP
rs757166373 36 dbSNP
rs1421504045 46 dbSNP
rs35135385 50 dbSNP
rs1170750901 51 dbSNP
rs1292098242 59 dbSNP
rs758320756 61 dbSNP
rs1220353255 62 dbSNP
rs752218028 63 dbSNP
rs1392123364 72 dbSNP
rs764904396 82 dbSNP
rs1465025441 83 dbSNP
rs754659787 92 dbSNP
rs947445538 95 dbSNP
rs1244729472 97 dbSNP
rs311679 101 dbSNP
rs867213035 109 dbSNP
rs942676284 117 dbSNP
rs145105824 118 dbSNP
rs1161386422 121 dbSNP
rs1412999982 122 dbSNP
rs1461081428 124 dbSNP
rs564516098 130 dbSNP
rs376804852 131 dbSNP
rs1246947497 142 dbSNP
rs922867793 154 dbSNP
rs1349100437 162 dbSNP
rs182779784 167 dbSNP
rs951590187 169 dbSNP
rs191743857 173 dbSNP
rs973822669 180 dbSNP
rs1252827194 181 dbSNP
rs761132492 182 dbSNP
rs572549565 212 dbSNP
rs554289336 213 dbSNP
rs1221942899 220 dbSNP
rs1251000860 227 dbSNP
rs564389498 231 dbSNP
rs1184474136 241 dbSNP
rs1252679580 245 dbSNP
rs1012329177 248 dbSNP
rs896145491 249 dbSNP
rs978776757 250 dbSNP
rs969215672 259 dbSNP
rs1369270892 263 dbSNP
rs1034973346 272 dbSNP
rs142904068 282 dbSNP
rs1350630544 285 dbSNP
rs1446641393 287 dbSNP
rs575104570 287 dbSNP
rs902376653 292 dbSNP
rs1035637719 300 dbSNP
rs993324372 308 dbSNP
rs138331901 312 dbSNP
rs1207268761 313 dbSNP
rs1368495363 329 dbSNP
rs1441984214 333 dbSNP
rs946544449 333 dbSNP
rs1325046308 345 dbSNP
rs1239446350 346 dbSNP
rs1473222354 347 dbSNP
rs1435682564 351 dbSNP
rs538545128 355 dbSNP
rs45501398 358 dbSNP
rs1399646051 361 dbSNP
rs560002977 362 dbSNP
rs1173956063 363 dbSNP
rs1375299565 363 dbSNP
rs533531592 365 dbSNP
rs199666551 377 dbSNP
rs888878590 377 dbSNP
rs1360568493 380 dbSNP
rs541903002 419 dbSNP
rs942730928 429 dbSNP
rs1394827882 431 dbSNP
rs1050076315 434 dbSNP
rs566594931 446 dbSNP
rs1230330690 448 dbSNP
rs912562724 466 dbSNP
rs987038703 469 dbSNP
rs114527282 475 dbSNP
rs1344147966 483 dbSNP
rs1198825035 485 dbSNP
rs918810148 486 dbSNP
rs974230989 489 dbSNP
rs1451831541 494 dbSNP
rs116000879 501 dbSNP
rs1280781768 510 dbSNP
rs1443046527 513 dbSNP
rs768736345 527 dbSNP
rs1240899853 546 dbSNP
rs6940611 554 dbSNP
rs1246414617 569 dbSNP
rs1443092165 573 dbSNP
rs879326909 575 dbSNP
rs1174796882 577 dbSNP
rs550321616 578 dbSNP
rs574507527 581 dbSNP
rs1414530363 583 dbSNP
rs934917314 606 dbSNP
rs924750093 607 dbSNP
rs1347477232 611 dbSNP
rs1302382797 616 dbSNP
rs1320925851 624 dbSNP
rs1330485524 627 dbSNP
rs1043219853 642 dbSNP
rs1034671462 644 dbSNP
rs947471498 657 dbSNP
rs182351801 661 dbSNP
rs6940429 663 dbSNP
rs142007156 666 dbSNP
rs775724930 666 dbSNP
rs928535671 666 dbSNP
rs1429344194 668 dbSNP
rs1022179714 680 dbSNP
rs546210335 690 dbSNP
rs1247796479 692 dbSNP
rs1314218570 695 dbSNP
rs1480481438 698 dbSNP
rs900324663 700 dbSNP
rs1040233941 704 dbSNP
rs1006958583 717 dbSNP
rs1409339556 726 dbSNP
rs891157386 737 dbSNP
rs971939348 747 dbSNP
rs961967187 750 dbSNP
rs311680 751 dbSNP
rs577640152 753 dbSNP
rs918843143 754 dbSNP
rs1286485824 760 dbSNP
rs1331285908 761 dbSNP
rs1186435833 765 dbSNP
rs1229295442 772 dbSNP
rs1038585418 773 dbSNP
rs1006488408 776 dbSNP
rs1291237263 777 dbSNP
rs953143326 777 dbSNP
rs1029193066 782 dbSNP
rs1180869503 783 dbSNP
rs1249039398 794 dbSNP
rs1367530116 795 dbSNP
rs1473275890 795 dbSNP
rs763350705 795 dbSNP
rs941563891 795 dbSNP
rs997188194 797 dbSNP
rs1366144612 798 dbSNP
rs1185958601 803 dbSNP
rs1024790411 806 dbSNP
rs7754197 807 dbSNP
rs960456835 810 dbSNP
rs1410509649 811 dbSNP
rs542344141 814 dbSNP
rs574944737 815 dbSNP
rs1270706255 816 dbSNP
rs1341862143 819 dbSNP
rs1203699888 820 dbSNP
rs1277384863 826 dbSNP
rs1213889170 827 dbSNP
rs1052059369 829 dbSNP
rs927672836 830 dbSNP
rs977752655 834 dbSNP
rs903464032 835 dbSNP
rs1043190529 837 dbSNP
rs947574055 838 dbSNP
rs556834800 844 dbSNP
rs534167440 847 dbSNP
rs1372258379 852 dbSNP
rs1462575150 855 dbSNP
rs577494644 861 dbSNP
rs558971462 864 dbSNP
rs534472674 868 dbSNP
rs71573596 871 dbSNP
rs548396318 876 dbSNP
rs1009119791 877 dbSNP
rs1162829001 878 dbSNP
rs1300457970 895 dbSNP
rs891229512 898 dbSNP
rs961936000 899 dbSNP
rs1051090394 900 dbSNP
rs994137956 901 dbSNP
rs1197462814 908 dbSNP
rs897154828 910 dbSNP
rs535952679 920 dbSNP
rs1392002205 921 dbSNP
rs778504797 922 dbSNP
rs1429017524 923 dbSNP
rs185116746 924 dbSNP
rs536316043 925 dbSNP
rs753372391 925 dbSNP
rs1337639539 927 dbSNP
rs916788845 929 dbSNP
rs1252538093 931 dbSNP
rs1242238500 933 dbSNP
rs1055315499 934 dbSNP
rs151244510 936 dbSNP
rs927704026 937 dbSNP
rs532188550 942 dbSNP
rs977827672 943 dbSNP
rs1274984170 945 dbSNP
rs753500287 951 dbSNP
rs779874132 953 dbSNP
rs1333512335 954 dbSNP
rs370053803 961 dbSNP
rs3959830 964 dbSNP
rs142432714 965 dbSNP
rs964675050 967 dbSNP
rs767830145 974 dbSNP
rs560492261 976 dbSNP
rs147681515 977 dbSNP
rs1397238956 978 dbSNP
rs530263923 979 dbSNP
rs1055979122 980 dbSNP
rs1324483173 981 dbSNP
rs552409705 982 dbSNP
rs1370345803 983 dbSNP
rs1406294796 984 dbSNP
rs1029736243 985 dbSNP
rs145246056 986 dbSNP
rs1226212820 987 dbSNP
rs1285844207 989 dbSNP
rs985072597 990 dbSNP
rs1220548669 992 dbSNP
rs577381525 995 dbSNP
rs921733773 996 dbSNP
rs540573669 997 dbSNP
rs1184621569 1003 dbSNP
rs1408980009 1004 dbSNP
rs368114259 1005 dbSNP
rs554186078 1007 dbSNP
rs967727722 1008 dbSNP
rs547336911 1010 dbSNP
rs1369414103 1011 dbSNP
rs1055748171 1015 dbSNP
rs370762638 1017 dbSNP
rs180918230 1018 dbSNP
rs1042186727 1019 dbSNP
rs945096599 1020 dbSNP
rs112896527 1021 dbSNP
rs533587196 1022 dbSNP
rs568129202 1026 dbSNP
rs940756878 1027 dbSNP
rs773044793 1030 dbSNP
rs576762657 1042 dbSNP
rs528414701 1043 dbSNP
rs188553832 1047 dbSNP
rs12528418 1054 dbSNP
rs184262956 1055 dbSNP
rs1026089945 1057 dbSNP
rs1446870577 1059 dbSNP
rs971841791 1060 dbSNP
rs1246435094 1061 dbSNP
rs181396255 1064 dbSNP
rs149739395 1065 dbSNP
rs573379542 1066 dbSNP
rs532592182 1067 dbSNP
rs1245121976 1068 dbSNP
rs1005555779 1070 dbSNP
rs1188307802 1079 dbSNP
rs895128058 1081 dbSNP
rs1033973308 1084 dbSNP
rs1344773667 1096 dbSNP
rs1177045269 1100 dbSNP
rs1451842881 1118 dbSNP
rs554705366 1123 dbSNP
rs565347576 1124 dbSNP
rs959197470 1148 dbSNP
rs1034639902 1149 dbSNP
rs540812903 1150 dbSNP
rs907330245 1155 dbSNP
rs1015107161 1159 dbSNP
rs945506518 1163 dbSNP
rs1432833521 1167 dbSNP
rs1270637200 1172 dbSNP
rs751997590 1181 dbSNP
rs1217541513 1186 dbSNP
rs1262376528 1193 dbSNP
rs765074303 1193 dbSNP
rs893561246 1193 dbSNP
rs1206313786 1200 dbSNP
rs1449045081 1204 dbSNP
rs1194529187 1211 dbSNP
rs1246636931 1214 dbSNP
rs1477443764 1217 dbSNP
rs1431027580 1218 dbSNP
rs1053914031 1219 dbSNP
rs1470023592 1222 dbSNP
rs943084804 1224 dbSNP
rs776482614 1234 dbSNP
rs4032696 1238 dbSNP
rs1049514415 1249 dbSNP
rs1434459785 1250 dbSNP
rs987377095 1262 dbSNP
rs1346182265 1271 dbSNP
rs933252051 1273 dbSNP
rs755779696 1276 dbSNP
rs971874435 1278 dbSNP
rs1353380142 1292 dbSNP
rs963507831 1301 dbSNP
rs554823588 1309 dbSNP
rs1017052042 1313 dbSNP
rs984607782 1322 dbSNP
rs1202175018 1327 dbSNP
rs996220680 1331 dbSNP
rs1480444710 1336 dbSNP
rs542252563 1337 dbSNP
rs1040310068 1346 dbSNP
rs781553118 1352 dbSNP
rs1471071411 1354 dbSNP
rs1301644645 1365 dbSNP
rs78673968 1366 dbSNP
rs923743803 1367 dbSNP
rs1403562230 1375 dbSNP
rs1304822941 1379 dbSNP
rs1409287309 1390 dbSNP
rs1286756801 1397 dbSNP
rs1337733792 1399 dbSNP
rs1042219433 1405 dbSNP
rs1366474864 1406 dbSNP
rs1354630008 1408 dbSNP
rs1225384626 1409 dbSNP
rs1293053982 1415 dbSNP
rs559666122 1417 dbSNP
rs1003519024 1421 dbSNP
rs915023765 1428 dbSNP
rs1248035179 1445 dbSNP
rs1420469038 1451 dbSNP
rs1182028065 1458 dbSNP
rs1367697828 1472 dbSNP
rs770878908 1479 dbSNP
rs1165471968 1485 dbSNP
rs1381081591 1487 dbSNP
rs1385773672 1510 dbSNP
rs1429248426 1513 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' augcggucAGUUAUGGAACACu 5'
                  ||  ||||||||| 
Target 5' ucucgaucUCCUUACCUUGUGa 3'
1 - 22
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000370315.3 | 3UTR | UCUCGAUCUCCUUACCUUGUGAUCCGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
83 hsa-miR-4457 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT098032 SOBP sine oculis binding protein homolog 2 2
MIRT202580 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 2 6
MIRT247137 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT349266 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT363756 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT443586 FAM84B family with sequence similarity 84 member B 2 2
MIRT452333 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 2
MIRT453864 ZBTB40 zinc finger and BTB domain containing 40 2 4
MIRT471486 PDE4D phosphodiesterase 4D 2 4
MIRT476290 GMFB glia maturation factor beta 2 8
MIRT479897 CCDC117 coiled-coil domain containing 117 2 4
MIRT484251 ANK1 ankyrin 1 2 2
MIRT491473 TMEM214 transmembrane protein 214 2 2
MIRT493804 GAN gigaxonin 2 6
MIRT499252 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT502271 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 4
MIRT504651 RPL9 ribosomal protein L9 2 6
MIRT505211 UBN2 ubinuclein 2 2 8
MIRT508952 SNRPB small nuclear ribonucleoprotein polypeptides B and B1 2 4
MIRT512691 POP1 POP1 homolog, ribonuclease P/MRP subunit 2 2
MIRT513320 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT513870 HOXA5 homeobox A5 2 2
MIRT517342 ZNF529 zinc finger protein 529 2 4
MIRT518947 LSG1 large 60S subunit nuclear export GTPase 1 2 2
MIRT520867 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT528325 GIGYF2 GRB10 interacting GYF protein 2 2 2
MIRT531990 SLCO1B3 solute carrier organic anion transporter family member 1B3 2 2
MIRT533298 USP46 ubiquitin specific peptidase 46 2 2
MIRT545257 TRIM36 tripartite motif containing 36 2 4
MIRT547038 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT556103 MOAP1 modulator of apoptosis 1 2 2
MIRT558321 DR1 down-regulator of transcription 1 2 2
MIRT558521 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT560906 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT568448 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT570586 OTUD7B OTU deubiquitinase 7B 2 2
MIRT572799 SIGLEC14 sialic acid binding Ig like lectin 14 2 2
MIRT573863 C9orf78 chromosome 9 open reading frame 78 2 2
MIRT575058 P2ry1 purinergic receptor P2Y, G-protein coupled 1 2 5
MIRT609931 SLC38A1 solute carrier family 38 member 1 2 4
MIRT610836 ZNF585A zinc finger protein 585A 2 4
MIRT611474 P2RY1 purinergic receptor P2Y1 2 7
MIRT613569 YY2 YY2 transcription factor 2 2
MIRT618626 GREB1 growth regulation by estrogen in breast cancer 1 2 2
MIRT620606 SAP30 Sin3A associated protein 30 2 2
MIRT621017 CLSTN3 calsyntenin 3 2 4
MIRT635314 FAM179A TOG array regulator of axonemal microtubules 2 2 2
MIRT635919 GLTSCR2 NOP53 ribosome biogenesis factor 2 2
MIRT640598 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT641784 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT644067 IQCE IQ motif containing E 2 2
MIRT648288 TRAPPC2L trafficking protein particle complex 2 like 2 2
MIRT658085 FOXR2 forkhead box R2 2 2
MIRT659077 DEPTOR DEP domain containing MTOR interacting protein 2 2
MIRT665307 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT665975 SYTL4 synaptotagmin like 4 2 2
MIRT666302 SLC25A25 solute carrier family 25 member 25 2 2
MIRT674906 RASSF9 Ras association domain family member 9 2 2
MIRT680086 THAP1 THAP domain containing 1 2 2
MIRT681488 DIP2A disco interacting protein 2 homolog A 2 2
MIRT691244 DFNB59 pejvakin 2 2
MIRT692362 AGTRAP angiotensin II receptor associated protein 2 2
MIRT693035 MB21D1 Mab-21 domain containing 1 2 2
MIRT693837 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT694479 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT696070 ZNF264 zinc finger protein 264 2 2
MIRT696578 TTC21B tetratricopeptide repeat domain 21B 2 2
MIRT696760 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 2
MIRT697307 ZNF652 zinc finger protein 652 2 2
MIRT700152 RNF115 ring finger protein 115 2 2
MIRT701056 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT701198 OTUD3 OTU deubiquitinase 3 2 2
MIRT701335 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT702656 ITGA3 integrin subunit alpha 3 2 2
MIRT703618 FBXO45 F-box protein 45 2 2
MIRT704673 CHTOP chromatin target of PRMT1 2 2
MIRT708894 ZNF780A zinc finger protein 780A 2 2
MIRT711620 DGKH diacylglycerol kinase eta 2 2
MIRT713745 TMEM81 transmembrane protein 81 2 2
MIRT719712 CD101 CD101 molecule 2 2
MIRT720294 DLGAP3 DLG associated protein 3 2 2
MIRT722606 CCDC152 coiled-coil domain containing 152 2 2
MIRT724566 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4457 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-miR-4457 Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-4457 Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-4457 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)

Error report submission