miRTarBase - #MIRT693904


—
pre-miRNA Information
pre-miRNA hsa-mir-4524a   
Genomic Coordinates chr17: 69099564 - 69099632
Description Homo sapiens miR-4524a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4524a-5p
Sequence 6| AUAGCAGCAUGAACCUGUCUCA |27
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1322445998 8 dbSNP
rs1350790266 13 dbSNP
rs1263495678 21 dbSNP
Putative Targets

Gene Information
Gene Symbol HNRNPA1L2   
Synonyms -
Description heterogeneous nuclear ribonucleoprotein A1-like 2
Transcript NM_001011724   
Other Transcripts NM_001011725   
Expression
Putative miRNA Targets on HNRNPA1L2
3'UTR of HNRNPA1L2
(miRNA target sites are highlighted)		 
>HNRNPA1L2|NM_001011724|3'UTR
   1 TTAGGAAACAAAGCTTAGCAGGAGAGGAGAGCCAGAGAAGTGACAGGGAAGCTACAGGTTACAACAGATTTGTGAACTCA
  81 GCCAAGCACAGTGGTGGCAGGGCCTAGCTGCTACAAAGAAGACATGTTTTAGACAAATACTCATGTGTATGGGCAAAAAA
 161 CTCGAGGACTGTATTTGTGACTAATTGTATAACAGGTTATTTTAGTTTCTGTTCTGTGGAAAGTGTAAAGCATTCCAACA
 241 AAGTGTTTTAATGTAGATTTTTTTTTTTGCACCCATGCTGTTGATTGCTAAATGTAATAGTCTGATTGTGACGCTGAATA
 321 AATGTCTCT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acuCUGUCCAAGUACGACGAUa 5'
             |:||||  |  ||||||| 
Target 5' ggtGGCAGGGCCTAGCTGCTAc 3'
 93 - 114 159.00 -18.90
2 
miRNA  3' acucuguccaaGUACGACGAUa 5'
                     |||||||:|: 
Target 5' ttttttgcaccCATGCTGTTGa 3'
 263 - 284 123.00 -11.90
3 
miRNA  3' acucUGUCCAAGUA----CGACGAUa 5'
              ||||||| ||    |:| ||: 
Target 5' tataACAGGTT-ATTTTAGTTTCTGt 3'
 188 - 212 99.00 -10.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN19666060 23 COSMIC
COSN30535901 63 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs760477749 1 dbSNP
rs531688506 20 dbSNP
rs201514314 23 dbSNP
rs1274490414 29 dbSNP
rs1340634012 45 dbSNP
rs1488127944 46 dbSNP
rs949421147 66 dbSNP
rs1212099086 73 dbSNP
rs1298039469 75 dbSNP
rs1283655084 93 dbSNP
rs1046413699 94 dbSNP
rs1248873879 101 dbSNP
rs1316162469 119 dbSNP
rs571905739 125 dbSNP
rs1359222563 132 dbSNP
rs1226233571 139 dbSNP
rs897241109 142 dbSNP
rs1344338592 143 dbSNP
rs1324001968 146 dbSNP
rs1274699267 148 dbSNP
rs534919764 154 dbSNP
rs554539104 164 dbSNP
rs1477899450 165 dbSNP
rs574591439 172 dbSNP
rs1425153394 176 dbSNP
rs888626674 186 dbSNP
rs1477302771 192 dbSNP
rs1462595497 195 dbSNP
rs149918578 197 dbSNP
rs1201512937 206 dbSNP
rs1018946202 223 dbSNP
rs1289878809 226 dbSNP
rs145252852 238 dbSNP
rs1161639397 240 dbSNP
rs551845012 241 dbSNP
rs2575975 245 dbSNP
rs1368623925 253 dbSNP
rs559797574 254 dbSNP
rs149175417 255 dbSNP
rs1329270420 258 dbSNP
rs978520944 258 dbSNP
rs925784872 268 dbSNP
rs796921596 269 dbSNP
rs1455021674 270 dbSNP
rs1338010933 271 dbSNP
rs1382428600 274 dbSNP
rs958788142 274 dbSNP
rs1446318323 279 dbSNP
rs1193285099 280 dbSNP
rs1271519340 287 dbSNP
rs1313287631 288 dbSNP
rs1369775492 289 dbSNP
rs1252782667 291 dbSNP
rs1179760451 298 dbSNP
rs991385147 307 dbSNP
rs1236401143 308 dbSNP
rs1198147292 309 dbSNP
rs143691199 310 dbSNP
rs1281072517 311 dbSNP
rs527814646 313 dbSNP
rs1389293609 314 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000342657.3 | 3UTR | GGUUACAACAGAUUUGUGAACUCAGCCAAGCACAGUGGUGGCAGGGCCUAGCUGCUACAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
180 hsa-miR-4524a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055251 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT055826 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT060573 CCND1 cyclin D1 2 2
MIRT061013 C1ORF21 chromosome 1 open reading frame 21 2 6
MIRT064694 CCND2 cyclin D2 2 4
MIRT075268 SNTB2 syntrophin beta 2 2 4
MIRT079668 NAPG NSF attachment protein gamma 2 12
MIRT081651 CCNE1 cyclin E1 2 4
MIRT082996 PNPLA6 patatin like phospholipase domain containing 6 2 2
MIRT083463 RALGAPB Ral GTPase activating protein non-catalytic beta subunit 2 4
MIRT085755 RIF1 replication timing regulatory factor 1 2 2
MIRT086022 UBR3 ubiquitin protein ligase E3 component n-recognin 3 (putative) 2 2
MIRT087431 ZNRF3 zinc and ring finger 3 2 2
MIRT088786 SOCS5 suppressor of cytokine signaling 5 2 2
MIRT089221 ACTR2 ARP2 actin related protein 2 homolog 2 2
MIRT093696 PI4K2B phosphatidylinositol 4-kinase type 2 beta 2 6
MIRT095090 SEC24A SEC24 homolog A, COPII coat complex component 2 4
MIRT096249 CANX calnexin 2 2
MIRT100215 PPP1R11 protein phosphatase 1 regulatory inhibitor subunit 11 2 2
MIRT100746 VEGFA vascular endothelial growth factor A 2 12
MIRT100904 CD2AP CD2 associated protein 2 2
MIRT102647 UBN2 ubinuclein 2 2 10
MIRT103882 FOXK1 forkhead box K1 2 2
MIRT104246 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT106310 ZFHX4 zinc finger homeobox 4 2 6
MIRT107696 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT114943 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 2
MIRT117671 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT133799 SKI SKI proto-oncogene 2 2
MIRT140167 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT142279 DCTN5 dynactin subunit 5 2 8
MIRT143288 N4BP1 NEDD4 binding protein 1 2 2
MIRT165939 CREBRF CREB3 regulatory factor 2 2
MIRT175251 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT186381 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT191470 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT196480 TAOK1 TAO kinase 1 2 2
MIRT201470 SNRPB2 small nuclear ribonucleoprotein polypeptide B2 2 8
MIRT204615 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204646 MOB4 MOB family member 4, phocein 2 8
MIRT204749 BZW1 basic leucine zipper and W2 domains 1 2 12
MIRT206031 NUP50 nucleoporin 50 2 6
MIRT211196 FGF2 fibroblast growth factor 2 2 4
MIRT229353 ZNF449 zinc finger protein 449 2 2
MIRT247138 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT249461 ZNF691 zinc finger protein 691 2 4
MIRT256314 CDC42SE2 CDC42 small effector 2 2 2
MIRT258419 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT265083 CHEK1 checkpoint kinase 1 2 2
MIRT270561 SETD1B SET domain containing 1B 2 2
MIRT274749 RAB3IP RAB3A interacting protein 2 2
MIRT277515 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 4
MIRT289642 CBX2 chromobox 2 2 2
MIRT301001 MTMR3 myotubularin related protein 3 2 2
MIRT307149 CTDSPL CTD small phosphatase like 2 4
MIRT309021 USP53 ubiquitin specific peptidase 53 2 2
MIRT314100 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 8
MIRT319338 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT320619 ZNRF2 zinc and ring finger 2 2 2
MIRT324285 LURAP1L leucine rich adaptor protein 1 like 2 2
MIRT446498 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT448437 TLL1 tolloid like 1 2 2
MIRT461537 ACTR3B ARP3 actin related protein 3 homolog B 2 2
MIRT463162 ZNF367 zinc finger protein 367 2 10
MIRT463493 ZC3H10 zinc finger CCCH-type containing 10 2 2
MIRT465154 TSC22D2 TSC22 domain family member 2 2 2
MIRT466418 TFAP2A transcription factor AP-2 alpha 2 8
MIRT468278 SFT2D2 SFT2 domain containing 2 2 2
MIRT469399 REL REL proto-oncogene, NF-kB subunit 2 6
MIRT471941 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT473688 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT479618 CDC25A cell division cycle 25A 2 2
MIRT482098 AKT3 AKT serine/threonine kinase 3 2 4
MIRT483995 ATAD5 ATPase family, AAA domain containing 5 2 12
MIRT485205 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 8
MIRT498763 C3orf38 chromosome 3 open reading frame 38 2 8
MIRT498961 ORC4 origin recognition complex subunit 4 2 8
MIRT499440 ODF2L outer dense fiber of sperm tails 2 like 2 8
MIRT500080 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 8
MIRT500305 ZNF622 zinc finger protein 622 2 8
MIRT500410 ZMAT3 zinc finger matrin-type 3 2 8
MIRT500789 TLK1 tousled like kinase 1 2 6
MIRT500930 SRPR SRP receptor alpha subunit 2 6
MIRT500943 SREK1 splicing regulatory glutamic acid and lysine rich protein 1 2 8
MIRT501068 SMAD7 SMAD family member 7 2 8
MIRT501711 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT502627 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT502910 CDCA4 cell division cycle associated 4 2 8
MIRT502935 CDC37L1 cell division cycle 37 like 1 2 8
MIRT504531 ZNF620 zinc finger protein 620 2 6
MIRT505106 YTHDC1 YTH domain containing 1 2 6
MIRT505337 TMEM245 transmembrane protein 245 2 6
MIRT505383 TMEM100 transmembrane protein 100 2 2
MIRT505678 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT506157 PLAG1 PLAG1 zinc finger 2 8
MIRT506183 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 6
MIRT506475 MYO5A myosin VA 2 6
MIRT506826 KIF23 kinesin family member 23 2 6
MIRT507160 GAS2L3 growth arrest specific 2 like 3 2 2
MIRT507511 DYNLL2 dynein light chain LC8-type 2 2 4
MIRT507845 CCNE2 cyclin E2 2 6
MIRT510403 ZNF507 zinc finger protein 507 2 2
MIRT518078 TRIM35 tripartite motif containing 35 2 2
MIRT518982 NNT nicotinamide nucleotide transhydrogenase 2 4
MIRT521045 SLC2A3 solute carrier family 2 member 3 2 4
MIRT521190 SBNO1 strawberry notch homolog 1 2 6
MIRT522088 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT524846 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT527787 TMEM44 transmembrane protein 44 2 4
MIRT537803 EFNB2 ephrin B2 2 4
MIRT540830 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541140 PISD phosphatidylserine decarboxylase 2 2
MIRT541419 CBX4 chromobox 4 2 2
MIRT543517 PRSS21 protease, serine 21 2 2
MIRT543824 GSG1 germ cell associated 1 2 2
MIRT544959 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT545179 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 4
MIRT545335 CCDC83 coiled-coil domain containing 83 2 2
MIRT545518 RSL24D1 ribosomal L24 domain containing 1 2 2
MIRT545670 DECR1 2,4-dienoyl-CoA reductase 1 2 2
MIRT545931 ZBTB44 zinc finger and BTB domain containing 44 2 4
MIRT546102 USP48 ubiquitin specific peptidase 48 2 4
MIRT546598 SALL1 spalt like transcription factor 1 2 4
MIRT546626 RTN4 reticulon 4 2 2
MIRT547651 KPNA3 karyopherin subunit alpha 3 2 2
MIRT547987 HCFC2 host cell factor C2 2 4
MIRT548717 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT548931 CDK17 cyclin dependent kinase 17 2 2
MIRT549067 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT549266 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT550460 OSCAR osteoclast associated, immunoglobulin-like receptor 2 4
MIRT550806 FAM229B family with sequence similarity 229 member B 2 2
MIRT552024 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT552334 ZNF704 zinc finger protein 704 2 2
MIRT552732 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT553795 SZRD1 SUZ RNA binding domain containing 1 2 4
MIRT554694 RNF149 ring finger protein 149 2 2
MIRT555133 PTPRD protein tyrosine phosphatase, receptor type D 2 2
MIRT555264 PRDM4 PR/SET domain 4 2 2
MIRT556848 KANK1 KN motif and ankyrin repeat domains 1 2 4
MIRT557474 GPR27 G protein-coupled receptor 27 2 4
MIRT558018 EXT1 exostosin glycosyltransferase 1 2 2
MIRT558498 CYP26B1 cytochrome P450 family 26 subfamily B member 1 2 4
MIRT558579 CREBL2 cAMP responsive element binding protein like 2 2 4
MIRT558610 COX6B1 cytochrome c oxidase subunit 6B1 2 4
MIRT558650 CNKSR3 CNKSR family member 3 2 2
MIRT558986 CA8 carbonic anhydrase 8 2 2
MIRT559141 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT559327 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT562021 LANCL1 LanC like 1 2 2
MIRT562869 KIAA1456 KIAA1456 2 2
MIRT563074 SLC25A12 solute carrier family 25 member 12 2 2
MIRT563496 DLGAP3 DLG associated protein 3 2 2
MIRT563890 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT564311 CCNT1 cyclin T1 2 2
MIRT564942 XKR7 XK related 7 2 2
MIRT564979 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT565423 TEF TEF, PAR bZIP transcription factor 2 2
MIRT566824 MAP3K7 mitogen-activated protein kinase kinase kinase 7 2 2
MIRT571961 KIF5B kinesin family member 5B 2 2
MIRT575877 Cask calcium/calmodulin-dependent serine protein kinase (MAGUK family) 2 3
MIRT576523 Txlna taxilin alpha 2 2
MIRT614693 TRAK1 trafficking kinesin protein 1 2 2
MIRT616065 ZC3H14 zinc finger CCCH-type containing 14 2 2
MIRT618838 ASAH2B N-acylsphingosine amidohydrolase 2B 2 2
MIRT624626 ATXN2 ataxin 2 2 2
MIRT624652 ASAH2 N-acylsphingosine amidohydrolase 2 2 2
MIRT640314 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT659248 CUL3 cullin 3 2 2
MIRT680972 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682261 RS1 retinoschisin 1 2 2
MIRT682505 GLP2R glucagon like peptide 2 receptor 2 2
MIRT693904 HNRNPA1L2 heterogeneous nuclear ribonucleoprotein A1-like 2 2 2
MIRT699214 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT699373 SLC30A6 solute carrier family 30 member 6 2 2
MIRT699451 SLC16A9 solute carrier family 16 member 9 2 2
MIRT701230 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT702849 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT706163 CASK calcium/calmodulin dependent serine protein kinase 2 3
MIRT718990 UTP15 UTP15, small subunit processome component 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4524a-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4524a-5p Cetuximab resistant tissue (colorectal carcinoma)

Error report submission