pre-miRNA Information
pre-miRNA hsa-mir-1185-1   
Genomic Coordinates chr14: 101042977 - 101043062
Synonyms MIRN1185-1, hsa-mir-1185-1, MIR1185-1
Description Homo sapiens miR-1185-1 stem-loop
Comment This sequence was proposed as a miRNA candidate by Berezikov et al by RAKE analysis .
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1185-1-3p
Sequence 53| AUAUACAGGGGGAGACUCUUAU |74
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 5 14 + 101043033 29233923 MiREDiBase
A-to-I 7 14 + 101043035 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs749794228 1 dbSNP
rs369414498 4 dbSNP
rs771096180 5 dbSNP
rs774958411 7 dbSNP
rs1226171972 11 dbSNP
rs1449899083 14 dbSNP
rs761183893 16 dbSNP
rs1380874583 20 dbSNP
rs771625921 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol COPB2   
Synonyms beta'-COP
Description coatomer protein complex subunit beta 2
Transcript NM_004766   
Expression
Putative miRNA Targets on COPB2
3'UTR of COPB2
(miRNA target sites are highlighted)
>COPB2|NM_004766|3'UTR
   1 CTGTAATGCTTTCCATTTACCTGACTAAACAGATCATTATTATATATAGGTATTGATTGCTACCCTGACCACAGTGCTTT
  81 GGACTATGAGAAACTTCTTAGATTTTTATATGTAAATGCTGTGGACCACTGGGAGCACAATGCCCACATCATCTTAAGAA
 161 GAGTTTATGTGCAGCATTTAAATCACTGTGTTTTCCTTGTTAACTAAAACAGACATGGGCTTTGATTTTTTTCATACTAT
 241 TAGACCATATCTCATAAAACCTTTTGAATTAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uauUCUCAGA--GGGGGACAUAua 5'
             ||  |:|   :| ||||:|  
Target 5' tgcAGCATTTAAATCACTGTGTtt 3'
170 - 193 109.00 -6.10
2
miRNA  3' uaUUCUCAGAGGG----GGACAUAUa 5'
            :|||  ||:|:    ::| |||| 
Target 5' atGAGAAACTTCTTAGATTTTTATAt 3'
86 - 111 106.00 -7.10
3
miRNA  3' uauucucagaGGGGGACAUAua 5'
                    ||:::|| ||  
Target 5' tctcataaaaCCTTTTGAATta 3'
250 - 271 84.00 -6.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20861950 1 COSMIC
COSN23267568 3 COSMIC
COSN30711664 46 COSMIC
COSN31564092 143 COSMIC
COSN29270749 160 COSMIC
COSN28321726 411 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs764934795 1 dbSNP
rs369587570 7 dbSNP
rs1422771197 10 dbSNP
rs762285973 13 dbSNP
rs199888455 19 dbSNP
rs764558644 21 dbSNP
rs1199515580 22 dbSNP
rs376939822 25 dbSNP
rs535903924 26 dbSNP
rs1260402521 27 dbSNP
rs1197101261 31 dbSNP
rs1317866442 35 dbSNP
rs1285282068 36 dbSNP
rs1247164414 37 dbSNP
rs1297117652 38 dbSNP
rs1393607191 40 dbSNP
rs1338760391 42 dbSNP
rs775881805 43 dbSNP
rs761404798 44 dbSNP
rs1447795259 46 dbSNP
rs772009404 49 dbSNP
rs373284424 50 dbSNP
rs1354716693 53 dbSNP
rs910382954 56 dbSNP
rs1322619139 57 dbSNP
rs1209127448 59 dbSNP
rs1204026593 64 dbSNP
rs979183846 65 dbSNP
rs1442839300 77 dbSNP
rs904599564 79 dbSNP
rs1043102687 87 dbSNP
rs1340767508 92 dbSNP
rs1010636977 97 dbSNP
rs1257476313 98 dbSNP
rs1297675967 100 dbSNP
rs1414903516 101 dbSNP
rs892078280 101 dbSNP
rs1424032086 111 dbSNP
rs1169260852 123 dbSNP
rs1041292600 132 dbSNP
rs566734118 136 dbSNP
rs1431159125 140 dbSNP
rs1215880921 149 dbSNP
rs968188199 153 dbSNP
rs1313658447 165 dbSNP
rs1020641064 166 dbSNP
rs988187463 181 dbSNP
rs1376475288 186 dbSNP
rs1283282405 190 dbSNP
rs1449141874 191 dbSNP
rs1377688312 192 dbSNP
rs151053981 196 dbSNP
rs746459541 199 dbSNP
rs1229311507 200 dbSNP
rs11545278 205 dbSNP
rs911352865 214 dbSNP
rs1050178475 216 dbSNP
rs1371780540 216 dbSNP
rs1035645282 226 dbSNP
rs1422178761 228 dbSNP
rs1485718886 234 dbSNP
rs1413318637 235 dbSNP
rs1416998932 237 dbSNP
rs931783331 238 dbSNP
rs777410825 241 dbSNP
rs920336193 247 dbSNP
rs1432793937 252 dbSNP
rs973115859 252 dbSNP
rs1359646136 253 dbSNP
rs1429816272 261 dbSNP
rs1472965411 266 dbSNP
rs1364417675 274 dbSNP
rs1436016361 277 dbSNP
rs962001229 277 dbSNP
rs1179819516 278 dbSNP
rs907816293 279 dbSNP
rs188194264 281 dbSNP
rs1280014323 282 dbSNP
rs1316815112 285 dbSNP
rs758050538 291 dbSNP
rs1214179170 300 dbSNP
rs1244181604 301 dbSNP
rs1465990229 302 dbSNP
rs992666164 307 dbSNP
rs1251873876 309 dbSNP
rs752368103 310 dbSNP
rs533337626 315 dbSNP
rs1034181737 329 dbSNP
rs1319422765 334 dbSNP
rs1288657426 335 dbSNP
rs980340928 344 dbSNP
rs1390477109 347 dbSNP
rs867174607 355 dbSNP
rs968856362 356 dbSNP
rs1438752059 358 dbSNP
rs1022117155 359 dbSNP
rs1010253385 368 dbSNP
rs1373322746 378 dbSNP
rs569915880 381 dbSNP
rs1019878428 385 dbSNP
rs1357697090 386 dbSNP
rs1272194012 389 dbSNP
rs1286836944 389 dbSNP
rs1466852129 392 dbSNP
rs1200442135 398 dbSNP
rs1409675678 399 dbSNP
rs182866596 404 dbSNP
rs754758160 406 dbSNP
rs1049959527 407 dbSNP
rs1472823548 408 dbSNP
rs771873471 410 dbSNP
rs1392641153 411 dbSNP
rs1349374335 416 dbSNP
rs1165675107 434 dbSNP
rs1324298507 442 dbSNP
rs753610127 445 dbSNP
rs1463197470 447 dbSNP
rs1440692694 449 dbSNP
rs931454844 451 dbSNP
rs1351622807 454 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000333188.5 | 3UTR | AUAACUAAAUCUGCAUUUUCAAAUGUUGUCAAUCACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
114 hsa-miR-1185-1-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066415 TBK1 TANK binding kinase 1 2 4
MIRT073567 NR2F2 nuclear receptor subfamily 2 group F member 2 2 2
MIRT074516 USP1 ubiquitin specific peptidase 1 2 4
MIRT080576 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 6
MIRT086539 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 2
MIRT086547 MOB4 MOB family member 4, phocein 2 2
MIRT088684 EML4 echinoderm microtubule associated protein like 4 2 4
MIRT090811 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT095500 PURA purine rich element binding protein A 2 2
MIRT109530 KLHL15 kelch like family member 15 2 6
MIRT109807 ZFX zinc finger protein, X-linked 2 2
MIRT117888 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT120273 GSK3B glycogen synthase kinase 3 beta 2 4
MIRT149892 LDLR low density lipoprotein receptor 2 2
MIRT178475 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT193445 RORA RAR related orphan receptor A 2 2
MIRT198527 DSG2 desmoglein 2 2 2
MIRT226427 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 2
MIRT227669 SET SET nuclear proto-oncogene 2 2
MIRT320405 HOXA9 homeobox A9 2 2
MIRT407774 MRPL35 mitochondrial ribosomal protein L35 2 2
MIRT439228 ZMIZ1 zinc finger MIZ-type containing 1 1 1
MIRT439312 VAT1L vesicle amine transport 1 like 1 1
MIRT439421 TMOD1 tropomodulin 1 1 1
MIRT439446 TMEM104 transmembrane protein 104 1 1
MIRT439524 STIM2 stromal interaction molecule 2 1 1
MIRT439612 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 1 1
MIRT439997 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT440017 PCSK1 proprotein convertase subtilisin/kexin type 1 1 1
MIRT440131 NCOA4 nuclear receptor coactivator 4 1 1
MIRT440311 LRRC1 leucine rich repeat containing 1 1 1
MIRT440475 IAPP islet amyloid polypeptide 1 1
MIRT440511 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 1 1
MIRT440617 FOXA2 forkhead box A2 1 1
MIRT440666 FBXL16 F-box and leucine rich repeat protein 16 1 1
MIRT440705 ERO1LB endoplasmic reticulum oxidoreductase 1 beta 1 1
MIRT441007 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 1 1
MIRT441018 CAND1 cullin associated and neddylation dissociated 1 1 1
MIRT441062 C1orf43 chromosome 1 open reading frame 43 1 1
MIRT441209 ARCN1 archain 1 1 1
MIRT449461 HAT1 histone acetyltransferase 1 2 2
MIRT467104 SRI sorcin 2 2
MIRT468060 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 10
MIRT468476 SESN3 sestrin 3 2 4
MIRT473533 MAX MYC associated factor X 2 2
MIRT473852 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT474711 KIF13A kinesin family member 13A 2 6
MIRT481665 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT485120 SF3B3 splicing factor 3b subunit 3 2 2
MIRT493055 MTFR1 mitochondrial fission regulator 1 2 2
MIRT504258 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT504361 ARID1B AT-rich interaction domain 1B 2 4
MIRT505748 SENP1 SUMO1/sentrin specific peptidase 1 2 8
MIRT506298 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 6
MIRT508442 ZNF608 zinc finger protein 608 2 4
MIRT512782 COL4A3BP collagen type IV alpha 3 binding protein 2 2
MIRT520447 TSPAN2 tetraspanin 2 2 4
MIRT522133 NRBF2 nuclear receptor binding factor 2 2 6
MIRT522395 MYADM myeloid associated differentiation marker 2 4
MIRT523397 GRIK3 glutamate ionotropic receptor kainate type subunit 3 2 4
MIRT523938 E2F8 E2F transcription factor 8 2 4
MIRT524349 CREB1 cAMP responsive element binding protein 1 2 2
MIRT524711 BRMS1L breast cancer metastasis-suppressor 1 like 2 4
MIRT525134 ZNF256 zinc finger protein 256 2 2
MIRT525710 DCAF12L2 DDB1 and CUL4 associated factor 12 like 2 2 2
MIRT531264 PPIL3 peptidylprolyl isomerase like 3 2 2
MIRT538844 BTG1 BTG anti-proliferation factor 1 2 2
MIRT541366 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT542093 KCNK10 potassium two pore domain channel subfamily K member 10 2 6
MIRT543770 RBM12B RNA binding motif protein 12B 2 4
MIRT543940 NCOA7 nuclear receptor coactivator 7 2 2
MIRT545150 GABRG1 gamma-aminobutyric acid type A receptor gamma1 subunit 2 2
MIRT545842 ZNF264 zinc finger protein 264 2 4
MIRT548057 GOLGA7 golgin A7 2 2
MIRT549242 ATXN1L ataxin 1 like 2 4
MIRT551829 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT552484 ZNF136 zinc finger protein 136 2 2
MIRT553663 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT554988 RAB39B RAB39B, member RAS oncogene family 2 2
MIRT555760 PCTP phosphatidylcholine transfer protein 2 2
MIRT556923 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 4
MIRT564991 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT566458 PGGT1B protein geranylgeranyltransferase type I subunit beta 2 2
MIRT566538 PANK3 pantothenate kinase 3 2 2
MIRT567732 DLX2 distal-less homeobox 2 2 2
MIRT570081 KANSL1L KAT8 regulatory NSL complex subunit 1 like 2 2
MIRT571735 RNF11 ring finger protein 11 2 2
MIRT573529 MDM2 MDM2 proto-oncogene 2 2
MIRT574459 RPS16 ribosomal protein S16 2 2
MIRT574992 Phka1 phosphorylase kinase alpha 1 2 3
MIRT576349 Pxdn peroxidasin 2 2
MIRT610196 CD99 CD99 molecule (Xg blood group) 2 4
MIRT612920 GPRIN3 GPRIN family member 3 2 2
MIRT615021 DUSP6 dual specificity phosphatase 6 2 2
MIRT623573 IRS1 insulin receptor substrate 1 2 2
MIRT624437 CASD1 CAS1 domain containing 1 2 2
MIRT628714 ZNF585A zinc finger protein 585A 2 2
MIRT639565 PCK1 phosphoenolpyruvate carboxykinase 1 2 4
MIRT641485 POLA2 DNA polymerase alpha 2, accessory subunit 2 2
MIRT641657 PAPOLG poly(A) polymerase gamma 2 2
MIRT642210 RUVBL2 RuvB like AAA ATPase 2 2 2
MIRT653010 STX7 syntaxin 7 2 2
MIRT656130 MSH6 mutS homolog 6 2 2
MIRT656893 KIAA2018 upstream transcription factor family member 3 2 2
MIRT660130 BRPF3 bromodomain and PHD finger containing 3 2 2
MIRT660855 AFAP1 actin filament associated protein 1 2 2
MIRT676843 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 3
MIRT681473 DIP2A disco interacting protein 2 homolog A 2 2
MIRT682253 RS1 retinoschisin 1 2 2
MIRT694296 COPB2 coatomer protein complex subunit beta 2 2 2
MIRT694401 ALDH1A3 aldehyde dehydrogenase 1 family member A3 2 2
MIRT705277 BACH1 BTB domain and CNC homolog 1 2 2
MIRT720833 C1orf52 chromosome 1 open reading frame 52 2 2
MIRT735713 SIRT1 sirtuin 1 2 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1185-1 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-1185-1 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-1185-1-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-1185-1-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-1185-1-3p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-1185-1-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1185-1-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1185-1-3p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1185-1-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1185-1-3p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-1185-1-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-1185-1-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-1185-1-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-1185-1-3p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-1185-1-3p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-1185-1-3p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-1185-1-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-1185-1-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-1185-1-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1185-1-3p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission