pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6839 |
Genomic Coordinates | chr7: 64679064 - 64679176 |
Description | Homo sapiens miR-6839 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6839-3p | ||||||||||||
Sequence | 92| UUGGGUUUUCUCUUCAAUCCAG |113 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | Meta-analysis | DRVs in miRNA |
|
||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |
---|---|
Gene Symbol | DHFRL1 |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Hela | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000314636.2 | 3UTR | AAACCCAUGGAGGUAACUACCAGAAGGAAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
62 hsa-miR-6839-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT059162 | TXNIP | thioredoxin interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT064872 | ZBTB18 | zinc finger and BTB domain containing 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT065802 | HOXC8 | homeobox C8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT106005 | SDCBP | syndecan binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT275773 | TFDP1 | transcription factor Dp-1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT314032 | PAPD7 | poly(A) RNA polymerase D7, non-canonical | ![]() |
![]() |
2 | 2 | ||||||
MIRT360277 | HIST1H2BE | histone cluster 1 H2B family member e | ![]() |
![]() |
2 | 8 | ||||||
MIRT360301 | HIST1H2BH | histone cluster 1 H2B family member h | ![]() |
![]() |
2 | 2 | ||||||
MIRT450086 | OR2A4 | olfactory receptor family 2 subfamily A member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468815 | RSRC2 | arginine and serine rich coiled-coil 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT475093 | IRF2BP2 | interferon regulatory factor 2 binding protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT477575 | EIF1AD | eukaryotic translation initiation factor 1A domain containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT483926 | LCORL | ligand dependent nuclear receptor corepressor like | ![]() |
![]() |
2 | 6 | ||||||
MIRT504381 | HIST1H1C | histone cluster 1 H1 family member c | ![]() |
![]() |
2 | 4 | ||||||
MIRT506970 | HNRNPUL1 | heterogeneous nuclear ribonucleoprotein U like 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT507028 | HIST1H3B | histone cluster 1 H3 family member b | ![]() |
![]() |
2 | 6 | ||||||
MIRT511561 | HIST3H2BB | histone cluster 3 H2B family member b | ![]() |
![]() |
2 | 4 | ||||||
MIRT511650 | HIST1H3D | histone cluster 1 H3 family member d | ![]() |
![]() |
2 | 6 | ||||||
MIRT511696 | HIST1H2BL | histone cluster 1 H2B family member l | ![]() |
![]() |
2 | 4 | ||||||
MIRT511737 | HIST1H2BB | histone cluster 1 H2B family member b | ![]() |
![]() |
2 | 6 | ||||||
MIRT511746 | HIST1H2BA | histone cluster 1 H2B family member a | ![]() |
![]() |
2 | 8 | ||||||
MIRT515260 | CSNK1E | casein kinase 1 epsilon | ![]() |
![]() |
2 | 2 | ||||||
MIRT516220 | RAB3B | RAB3B, member RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT523281 | HIST1H1E | histone cluster 1 H1 family member e | ![]() |
![]() |
2 | 2 | ||||||
MIRT524121 | DMXL1 | Dmx like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530744 | GPR82 | G protein-coupled receptor 82 | ![]() |
![]() |
2 | 2 | ||||||
MIRT532214 | CCDC117 | coiled-coil domain containing 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546182 | TPRG1L | tumor protein p63 regulated 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT558638 | CNNM2 | cyclin and CBS domain divalent metal cation transport mediator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559562 | ARF1 | ADP ribosylation factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT560680 | HIST1H1T | histone cluster 1 H1 family member t | ![]() |
![]() |
2 | 2 | ||||||
MIRT570746 | AAK1 | AP2 associated kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609518 | RAB3IP | RAB3A interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT612583 | SYNGAP1 | synaptic Ras GTPase activating protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT615733 | RIOK3 | RIO kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT616068 | SIX1 | SIX homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617903 | SGCD | sarcoglycan delta | ![]() |
![]() |
2 | 2 | ||||||
MIRT620851 | SERPING1 | serpin family G member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625107 | SLC1A5 | solute carrier family 1 member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625120 | NUP93 | nucleoporin 93 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625893 | LINC00632 | long intergenic non-protein coding RNA 632 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626569 | MED7 | mediator complex subunit 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626694 | ZFP14 | ZFP14 zinc finger protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT626808 | PRR11 | proline rich 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628131 | HM13 | histocompatibility minor 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636596 | DCAF5 | DDB1 and CUL4 associated factor 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649866 | SLFN12L | schlafen family member 12 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT652133 | TRPM7 | transient receptor potential cation channel subfamily M member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652663 | TIMELESS | timeless circadian clock | ![]() |
![]() |
2 | 2 | ||||||
MIRT658335 | FAM83D | family with sequence similarity 83 member D | ![]() |
![]() |
2 | 2 | ||||||
MIRT660615 | ANKS4B | ankyrin repeat and sterile alpha motif domain containing 4B | ![]() |
![]() |
2 | 2 | ||||||
MIRT666304 | SLC22A3 | solute carrier family 22 member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668528 | ERGIC2 | ERGIC and golgi 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692510 | PARD3 | par-3 family cell polarity regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT694784 | DHFRL1 | dihydrofolate reductase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700510 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701438 | NFYA | nuclear transcription factor Y subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT710155 | MTRF1L | mitochondrial translational release factor 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT711436 | DLC1 | DLC1 Rho GTPase activating protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT716979 | GPR155 | G protein-coupled receptor 155 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720155 | POU2F2 | POU class 2 homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722512 | DSTYK | dual serine/threonine and tyrosine protein kinase | ![]() |
![]() |
2 | 2 |