pre-miRNA Information
pre-miRNA hsa-mir-4433a   
Genomic Coordinates chr2: 64340759 - 64340839
Description Homo sapiens miR-4433a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4433a-3p
Sequence 51| ACAGGAGUGGGGGUGGGACAU |71
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs751480515 9 dbSNP
rs557760377 15 dbSNP
rs1479580865 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TCTN2   
Synonyms C12orf38, JBTS24, MKS8, TECT2
Description tectonic family member 2
Transcript NM_001143850   
Other Transcripts NM_024809   
Expression
Putative miRNA Targets on TCTN2
3'UTR of TCTN2
(miRNA target sites are highlighted)
>TCTN2|NM_001143850|3'UTR
   1 ACAACCACCTGGCTTTTATTTTTTTGAGATGGAGTTTTGCTCTTGTTGCCCAGGCTGAAGTGATCTCGGCTCACCACAAC
  81 CTCCTCCTCTTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCGGAGAACTGGGATTACAGGCATGCACCACCACGCCCGG
 161 CTAATTTTGTATTTTTAGTAGAGACAGGGTTCCACCGTATTGGCCAGGCTGCTCTCGAACTCCTGACCTCATGATCCGCC
 241 CATCTTGGCCTCCCAAAGTGCTGAGATTACAGGCATGAGCCACCGCACCCGGCCTTTTTTTTTTTTTTTTTTTTTTTGAG
 321 GCGGGGTCTCTGTCACCCAGGCTGGAGTGCAGTGCACAATCTCGGCTCACTGCAATCTCTGCCTCCCAAGCAATCCTCCC
 401 ACCTCAGCCTCTGGTGTAGCTGGGACCACAGATGCTCCACCATGCCTGGCTGTATTTTTGGTAAAGACGGGGTTTCGCCT
 481 TGTTGCCCAGGGTGGTCTGTAACTCCTGAGCTCAGATGATCTGCCCACCTCGGCCTCCCAAAGTGCTGGGATCACAGACG
 561 TGAGCCACTGCGTCCGGTCCATCTGACTTCTCAAAGACTTTAGACCTTGACTTCAGTGATTTGTTGTAGTCTTGTATGCT
 641 TCTCTATAAAATTTTAATAAATGAAATGTCTTATTTTTGTAGAAAATTTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uacagGGUGGGGG--UGAGGACa 5'
               |::|:|:|  ||||||| 
Target 5' ccaggCTGCTCTCGAACTCCTGa 3'
204 - 226 154.00 -18.00
2
miRNA  3' uacaggguGGGGGUGAGGACa 5'
                  |: : ||||||| 
Target 5' agggtggtCTGTAACTCCTGa 3'
489 - 509 141.00 -13.80
3
miRNA  3' uaCAGGGUGGGGGUGAGGACa 5'
            ||:| | |  : |||||| 
Target 5' ggGTTCAAGCGATTCTCCTGc 3'
92 - 112 123.00 -12.89
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
307562 46 ClinVar
368984 68 ClinVar
881390 72 ClinVar
307563 88 ClinVar
881391 147 ClinVar
307564 156 ClinVar
307565 167 ClinVar
307566 259 ClinVar
881834 291 ClinVar
1188076 295 ClinVar
307567 328 ClinVar
307568 413 ClinVar
307569 469 ClinVar
882984 478 ClinVar
882985 494 ClinVar
883782 560 ClinVar
883783 563 ClinVar
307570 588 ClinVar
881451 609 ClinVar
COSN26998178 15 COSMIC
COSN26769583 18 COSMIC
COSN26465123 19 COSMIC
COSN32052806 39 COSMIC
COSN1143833 70 COSMIC
COSN31555833 70 COSMIC
COSN30162534 84 COSMIC
COSN31550368 123 COSMIC
COSN1143835 155 COSMIC
COSN21081334 387 COSMIC
COSN5933262 614 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1173914895 1 dbSNP
rs765700192 2 dbSNP
rs1466893605 3 dbSNP
rs1376847579 8 dbSNP
rs751115932 10 dbSNP
rs746206461 12 dbSNP
rs1268507099 15 dbSNP
rs761332104 19 dbSNP
rs1435206102 23 dbSNP
rs766893144 28 dbSNP
rs1363783523 31 dbSNP
rs1458208156 34 dbSNP
rs750095290 37 dbSNP
rs1392325407 39 dbSNP
rs755663844 40 dbSNP
rs917154592 44 dbSNP
rs142969969 46 dbSNP
rs1420891279 47 dbSNP
rs1368049091 50 dbSNP
rs372047920 51 dbSNP
rs1159968358 54 dbSNP
rs1468098832 60 dbSNP
rs912259913 64 dbSNP
rs112214860 68 dbSNP
rs541966085 69 dbSNP
rs544472748 70 dbSNP
rs1287989001 78 dbSNP
rs936477989 81 dbSNP
rs113292231 88 dbSNP
rs1284851167 89 dbSNP
rs1247309251 90 dbSNP
rs1368699450 98 dbSNP
rs895222303 102 dbSNP
rs1281909470 103 dbSNP
rs1400954775 112 dbSNP
rs1296947642 115 dbSNP
rs1400630534 116 dbSNP
rs1406655774 119 dbSNP
rs949476701 123 dbSNP
rs766896057 124 dbSNP
rs1415156319 140 dbSNP
rs1046414186 147 dbSNP
rs890707707 149 dbSNP
rs1265046318 155 dbSNP
rs12811354 156 dbSNP
rs1446325954 158 dbSNP
rs1005305742 159 dbSNP
rs1211668131 160 dbSNP
rs1017185343 162 dbSNP
rs886049057 167 dbSNP
rs779901008 170 dbSNP
rs1342848006 173 dbSNP
rs899417407 175 dbSNP
rs1268754280 178 dbSNP
rs1488670132 191 dbSNP
rs996359196 193 dbSNP
rs1029152858 194 dbSNP
rs953784961 195 dbSNP
rs1323680629 196 dbSNP
rs1406536070 197 dbSNP
rs986488654 198 dbSNP
rs1192890485 203 dbSNP
rs1163831210 214 dbSNP
rs1266678628 217 dbSNP
rs1019335435 218 dbSNP
rs1184536804 225 dbSNP
rs1475058443 231 dbSNP
rs755471021 238 dbSNP
rs181244080 239 dbSNP
rs925221238 249 dbSNP
rs1467149321 253 dbSNP
rs1272619397 255 dbSNP
rs540710300 259 dbSNP
rs990637761 261 dbSNP
rs1271346905 263 dbSNP
rs1169250998 265 dbSNP
rs1350882587 269 dbSNP
rs916440200 271 dbSNP
rs949218468 283 dbSNP
rs1277061292 285 dbSNP
rs868453163 286 dbSNP
rs1345423703 287 dbSNP
rs900715059 288 dbSNP
rs1046489860 289 dbSNP
rs886531596 291 dbSNP
rs1359894003 292 dbSNP
rs1452464905 294 dbSNP
rs1231326461 295 dbSNP
rs1232793757 295 dbSNP
rs1281161927 295 dbSNP
rs1296451134 295 dbSNP
rs1302092989 295 dbSNP
rs1313211176 295 dbSNP
rs1347765079 295 dbSNP
rs1446835992 295 dbSNP
rs1459280696 295 dbSNP
rs983291114 295 dbSNP
rs1214252184 305 dbSNP
rs1290820837 318 dbSNP
rs753743915 318 dbSNP
rs1322175196 319 dbSNP
rs1224421919 320 dbSNP
rs1289252022 321 dbSNP
rs375171730 323 dbSNP
rs1194247585 324 dbSNP
rs559770401 325 dbSNP
rs1474128883 326 dbSNP
rs1159330626 327 dbSNP
rs1441559881 328 dbSNP
rs1488442774 328 dbSNP
rs72194541 329 dbSNP
rs1239633119 330 dbSNP
rs56918215 331 dbSNP
rs1414068104 340 dbSNP
rs1407496276 342 dbSNP
rs1162079646 352 dbSNP
rs940663904 355 dbSNP
rs527407608 356 dbSNP
rs1222896756 357 dbSNP
rs1300557043 360 dbSNP
rs1314519911 363 dbSNP
rs1412620815 364 dbSNP
rs1374784706 365 dbSNP
rs1324798849 369 dbSNP
rs1430099176 377 dbSNP
rs1455277801 378 dbSNP
rs1285065773 392 dbSNP
rs1038148476 394 dbSNP
rs186632954 403 dbSNP
rs1243968296 406 dbSNP
rs866900423 410 dbSNP
rs112525270 413 dbSNP
rs1186267038 419 dbSNP
rs959371089 428 dbSNP
rs1264334353 434 dbSNP
rs146922227 443 dbSNP
rs890593335 462 dbSNP
rs915317514 463 dbSNP
rs7398298 469 dbSNP
rs1286223200 477 dbSNP
rs147565143 478 dbSNP
rs1214447442 480 dbSNP
rs778857690 480 dbSNP
rs1237498398 493 dbSNP
rs569489612 494 dbSNP
rs1181316603 495 dbSNP
rs1385055538 496 dbSNP
rs1354654473 500 dbSNP
rs1440663264 501 dbSNP
rs1278571460 509 dbSNP
rs1161044977 511 dbSNP
rs1383903065 512 dbSNP
rs1382633728 514 dbSNP
rs1383422281 517 dbSNP
rs1400574239 518 dbSNP
rs1288397372 523 dbSNP
rs977777592 524 dbSNP
rs1032451636 526 dbSNP
rs879395160 532 dbSNP
rs1163129092 533 dbSNP
rs1039275578 540 dbSNP
rs191861205 546 dbSNP
rs1427290366 560 dbSNP
rs772401980 563 dbSNP
rs949166273 564 dbSNP
rs1240602199 572 dbSNP
rs531923705 576 dbSNP
rs1211481495 577 dbSNP
rs907952575 582 dbSNP
rs940806996 587 dbSNP
rs548909798 588 dbSNP
rs1005079724 591 dbSNP
rs1278735313 598 dbSNP
rs1387269219 600 dbSNP
rs1373376084 602 dbSNP
rs1323939981 616 dbSNP
rs1024100197 618 dbSNP
rs1401248306 619 dbSNP
rs1001422932 624 dbSNP
rs920617400 624 dbSNP
rs1201426069 627 dbSNP
rs1242138163 632 dbSNP
rs1034284302 645 dbSNP
rs539922879 652 dbSNP
rs536134666 654 dbSNP
rs1458538144 670 dbSNP
rs1184441889 671 dbSNP
rs1191154851 679 dbSNP
rs957305046 681 dbSNP
rs1250710066 682 dbSNP
rs1197351982 684 dbSNP
rs576381856 686 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' uacagGGUGGGGG--UGAGGACa 5'
               |::|:|:|  ||||||| 
Target 5' -caggCUGCUCUCGAACUCCUGa 3'
1 - 22
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000303372.5 | 3UTR | CAGGCUGCUCUCGAACUCCUGACCUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
256 hsa-miR-4433a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT088097 SEPT2 septin 2 2 2
MIRT143134 MGRN1 mahogunin ring finger 1 2 2
MIRT153912 NCOA3 nuclear receptor coactivator 3 2 2
MIRT154894 GNAS GNAS complex locus 2 4
MIRT200996 ZNF805 zinc finger protein 805 2 2
MIRT215729 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT235593 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT263250 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT317951 CDC5L cell division cycle 5 like 2 4
MIRT325572 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT354739 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 2 2
MIRT444552 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 4
MIRT446978 SUSD5 sushi domain containing 5 2 2
MIRT451036 ZNF610 zinc finger protein 610 2 2
MIRT451596 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT452025 NLRP6 NLR family pyrin domain containing 6 2 2
MIRT452594 CA6 carbonic anhydrase 6 2 2
MIRT452768 TCEA3 transcription elongation factor A3 2 4
MIRT452959 ZNF844 zinc finger protein 844 2 2
MIRT453191 ACSF2 acyl-CoA synthetase family member 2 2 2
MIRT453382 RHD Rh blood group D antigen 2 2
MIRT453685 CEBPD CCAAT/enhancer binding protein delta 2 2
MIRT455272 DDX39B DExD-box helicase 39B 2 8
MIRT455346 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT456494 SERAC1 serine active site containing 1 2 2
MIRT456585 NID1 nidogen 1 2 2
MIRT456888 DDA1 DET1 and DDB1 associated 1 2 2
MIRT457123 APOLD1 apolipoprotein L domain containing 1 2 2
MIRT457852 ZNF324B zinc finger protein 324B 2 2
MIRT457987 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT459278 APOBEC3F apolipoprotein B mRNA editing enzyme catalytic subunit 3F 2 2
MIRT459625 SLC25A33 solute carrier family 25 member 33 2 2
MIRT459715 SGK494 uncharacterized serine/threonine-protein kinase SgK494 2 2
MIRT460057 RPL22L1 ribosomal protein L22 like 1 2 2
MIRT460182 UNK unkempt family zinc finger 2 6
MIRT460288 PDE11A phosphodiesterase 11A 2 2
MIRT460841 EGF epidermal growth factor 2 4
MIRT460860 TBC1D19 TBC1 domain family member 19 2 2
MIRT461519 EMC7 ER membrane protein complex subunit 7 2 2
MIRT461729 SLC27A1 solute carrier family 27 member 1 2 4
MIRT461821 SNAP23 synaptosome associated protein 23 2 2
MIRT462066 CCDC77 coiled-coil domain containing 77 2 4
MIRT462084 MSANTD2 Myb/SANT DNA binding domain containing 2 2 2
MIRT462508 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 10
MIRT464239 VCP valosin containing protein 2 2
MIRT465316 TRAF5 TNF receptor associated factor 5 2 2
MIRT466549 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT467128 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 8
MIRT468091 SHCBP1 SHC binding and spindle associated 1 2 2
MIRT469630 RAD21 RAD21 cohesin complex component 2 6
MIRT471097 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT472704 MYBL1 MYB proto-oncogene like 1 2 2
MIRT472830 MTMR10 myotubularin related protein 10 2 2
MIRT472872 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT472895 MTDH metadherin 2 2
MIRT473728 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT473859 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT474047 LONRF1 LON peptidase N-terminal domain and ring finger 1 2 2
MIRT474297 LAMC1 laminin subunit gamma 1 2 2
MIRT474658 KLF13 Kruppel like factor 13 2 2
MIRT475234 IKZF3 IKAROS family zinc finger 3 2 2
MIRT475500 HSP90B1 heat shock protein 90 beta family member 1 2 2
MIRT475742 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT475793 HDGF heparin binding growth factor 2 2
MIRT477254 ERGIC2 ERGIC and golgi 2 2 2
MIRT478228 DDX52 DExD-box helicase 52 2 2
MIRT478393 DCTN5 dynactin subunit 5 2 2
MIRT478754 CS citrate synthase 2 2
MIRT478827 CRKL CRK like proto-oncogene, adaptor protein 2 4
MIRT480234 C9orf41 carnosine N-methyltransferase 1 2 2
MIRT480597 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT484121 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT484689 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT486331 C11orf54 chromosome 11 open reading frame 54 2 4
MIRT488599 FAM3C family with sequence similarity 3 member C 2 8
MIRT488833 MRRF mitochondrial ribosome recycling factor 2 2
MIRT492523 RAB15 RAB15, member RAS oncogene family 2 4
MIRT493632 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT500026 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501075 SMAD7 SMAD family member 7 2 8
MIRT503094 BTG2 BTG anti-proliferation factor 2 2 4
MIRT503336 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT505465 STMN1 stathmin 1 2 4
MIRT505726 SERTAD3 SERTA domain containing 3 2 4
MIRT509333 MS4A4A membrane spanning 4-domains A4A 2 2
MIRT509978 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 4
MIRT513068 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT513446 EMP1 epithelial membrane protein 1 2 6
MIRT513736 PSD3 pleckstrin and Sec7 domain containing 3 2 4
MIRT513996 CENPQ centromere protein Q 2 4
MIRT516538 MIXL1 Mix paired-like homeobox 2 2
MIRT517606 SAV1 salvador family WW domain containing protein 1 2 2
MIRT518064 CEP89 centrosomal protein 89 2 2
MIRT518119 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT518325 WDR92 WD repeat domain 92 2 2
MIRT519048 ABCB11 ATP binding cassette subfamily B member 11 2 2
MIRT520972 SPPL2A signal peptide peptidase like 2A 2 4
MIRT521359 RPL35A ribosomal protein L35a 2 2
MIRT523359 GTF3C6 general transcription factor IIIC subunit 6 2 2
MIRT523801 FAM63A MINDY lysine 48 deubiquitinase 1 2 2
MIRT524622 C7orf73 short transmembrane mitochondrial protein 1 2 2
MIRT525550 PHB2 prohibitin 2 2 4
MIRT529709 ZBTB49 zinc finger and BTB domain containing 49 2 2
MIRT531605 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT532387 UMPS uridine monophosphate synthetase 2 2
MIRT534468 SCD stearoyl-CoA desaturase 2 4
MIRT537546 ETNK1 ethanolamine kinase 1 2 2
MIRT541619 C11orf31 selenoprotein H 2 2
MIRT548380 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT549523 HDDC2 HD domain containing 2 2 2
MIRT549774 SOD2 superoxide dismutase 2 2 2
MIRT550578 SLC2A5 solute carrier family 2 member 5 2 2
MIRT551498 CENPN centromere protein N 2 4
MIRT552301 ITGA3 integrin subunit alpha 3 2 2
MIRT555400 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT556399 LUC7L LUC7 like 2 2
MIRT557047 HOXB3 homeobox B3 2 2
MIRT558072 ERO1L endoplasmic reticulum oxidoreductase 1 alpha 1 2
MIRT559659 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT561239 ZNF354B zinc finger protein 354B 2 2
MIRT566899 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT568786 FAM120B family with sequence similarity 120B 2 2
MIRT574014 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT574885 Dnajc6 DnaJ heat shock protein family (Hsp40) member C6 2 2
MIRT575243 Serping1 serine (or cysteine) peptidase inhibitor, clade G, member 1 2 2
MIRT576194 Vsig2 V-set and immunoglobulin domain containing 2 2 2
MIRT576309 Acbd7 acyl-Coenzyme A binding domain containing 7 2 2
MIRT576484 Lhx4 LIM homeobox protein 4 2 3
MIRT576646 Mill2 MHC I like leukocyte 2 1 1
MIRT576708 Kras Kirsten rat sarcoma viral oncogene homolog 2 2
MIRT576855 Socs6 suppressor of cytokine signaling 6 2 2
MIRT576950 Aldoa aldolase A, fructose-bisphosphate 2 2
MIRT617133 ZNF556 zinc finger protein 556 2 4
MIRT617928 ZNF783 zinc finger family member 783 2 2
MIRT618981 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT621100 SIX3 SIX homeobox 3 2 2
MIRT624537 BROX BRO1 domain and CAAX motif containing 2 2
MIRT625663 C2orf48 chromosome 2 open reading frame 48 2 2
MIRT627059 DCTN6 dynactin subunit 6 2 2
MIRT628319 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT630859 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 2
MIRT632295 TMEM65 transmembrane protein 65 2 2
MIRT634115 ZNF207 zinc finger protein 207 2 2
MIRT634736 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT635655 NDST3 N-deacetylase and N-sulfotransferase 3 2 2
MIRT635772 PDCL3 phosducin like 3 2 2
MIRT635911 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT636365 OGFRL1 opioid growth factor receptor like 1 2 4
MIRT637251 GLRX2 glutaredoxin 2 2 2
MIRT638705 FZD4 frizzled class receptor 4 2 2
MIRT639640 PREX2 phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 2 2 2
MIRT639676 PPEF2 protein phosphatase with EF-hand domain 2 2 4
MIRT642267 SMIM17 small integral membrane protein 17 2 2
MIRT642372 ZNF581 zinc finger protein 581 2 2
MIRT643545 SLC25A17 solute carrier family 25 member 17 2 2
MIRT647994 PDE12 phosphodiesterase 12 2 2
MIRT649094 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT650993 ZNF770 zinc finger protein 770 2 2
MIRT651956 UBE2N ubiquitin conjugating enzyme E2 N 2 2
MIRT652977 SUN2 Sad1 and UNC84 domain containing 2 2 2
MIRT654389 RBM12B RNA binding motif protein 12B 2 2
MIRT655637 OLFML2A olfactomedin like 2A 2 2
MIRT655729 NRXN3 neurexin 3 2 2
MIRT658171 FCHSD1 FCH and double SH3 domains 1 2 2
MIRT660937 ACOX1 acyl-CoA oxidase 1 2 2
MIRT662112 CERKL ceramide kinase like 2 2
MIRT662302 MPV17L MPV17 mitochondrial inner membrane protein like 2 2
MIRT662993 TMEM59 transmembrane protein 59 2 2
MIRT663071 SFR1 SWI5 dependent homologous recombination repair protein 1 2 2
MIRT663704 ABHD17B abhydrolase domain containing 17B 2 2
MIRT663864 MUC20 mucin 20, cell surface associated 2 2
MIRT665185 HAUS5 HAUS augmin like complex subunit 5 2 4
MIRT665402 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT665688 TNPO3 transportin 3 2 2
MIRT665795 TMEM170A transmembrane protein 170A 2 2
MIRT665847 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT666999 PDPN podoplanin 2 2
MIRT667598 LIPC lipase C, hepatic type 2 2
MIRT668576 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 4
MIRT670960 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT671187 ZNF891 zinc finger protein 891 2 2
MIRT671739 ZNF451 zinc finger protein 451 2 2
MIRT672745 ZNF585B zinc finger protein 585B 2 4
MIRT673446 ZNF583 zinc finger protein 583 2 2
MIRT679843 GPR75 G protein-coupled receptor 75 2 2
MIRT680556 ZNF584 zinc finger protein 584 2 2
MIRT680661 C1orf210 chromosome 1 open reading frame 210 2 2
MIRT681285 RFC2 replication factor C subunit 2 2 2
MIRT683264 ZNF329 zinc finger protein 329 2 2
MIRT684519 C1orf174 chromosome 1 open reading frame 174 2 2
MIRT685065 GEMIN4 gem nuclear organelle associated protein 4 2 2
MIRT685157 DTWD2 DTW domain containing 2 2 2
MIRT685168 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT685470 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT686001 NEK4 NIMA related kinase 4 2 2
MIRT687027 RNF24 ring finger protein 24 2 2
MIRT687543 MOB1B MOB kinase activator 1B 2 2
MIRT687592 MANEAL mannosidase endo-alpha like 2 2
MIRT687753 KIAA1328 KIAA1328 2 2
MIRT688050 GLUL glutamate-ammonia ligase 2 2
MIRT688374 ENPP1 ectonucleotide pyrophosphatase/phosphodiesterase 1 2 2
MIRT688802 CBFA2T3 CBFA2/RUNX1 translocation partner 3 2 2
MIRT688957 ATXN3 ataxin 3 2 2
MIRT689281 C5AR2 complement component 5a receptor 2 2 2
MIRT689988 NNMT nicotinamide N-methyltransferase 2 2
MIRT689997 MMP17 matrix metallopeptidase 17 2 2
MIRT690014 LUZP2 leucine zipper protein 2 2 2
MIRT690161 ELP3 elongator acetyltransferase complex subunit 3 2 2
MIRT690379 ZSWIM7 zinc finger SWIM-type containing 7 2 2
MIRT690563 MICA MHC class I polypeptide-related sequence A 2 2
MIRT691891 EVC EvC ciliary complex subunit 1 2 2
MIRT693107 SCNM1 sodium channel modifier 1 2 2
MIRT693832 ZFP64 ZFP64 zinc finger protein 2 2
MIRT694105 ZNF446 zinc finger protein 446 2 2
MIRT694179 ZNF486 zinc finger protein 486 2 2
MIRT694475 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT694998 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT695031 ALG10B ALG10B, alpha-1,2-glucosyltransferase 2 2
MIRT695163 TCTN2 tectonic family member 2 2 2
MIRT695525 SLC25A34 solute carrier family 25 member 34 2 2
MIRT696067 ZNF264 zinc finger protein 264 2 2
MIRT696616 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT696661 AGXT2 alanine--glyoxylate aminotransferase 2 2 2
MIRT696705 PNPO pyridoxamine 5'-phosphate oxidase 2 2
MIRT697173 INMT indolethylamine N-methyltransferase 2 2
MIRT697303 ZNF652 zinc finger protein 652 2 2
MIRT697491 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT698657 TERF2 telomeric repeat binding factor 2 2 2
MIRT699042 SOAT1 sterol O-acyltransferase 1 2 2
MIRT699185 SLX4IP SLX4 interacting protein 2 2
MIRT699598 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT700150 RNF115 ring finger protein 115 2 2
MIRT700720 PNO1 partner of NOB1 homolog 2 2
MIRT700870 PER2 period circadian clock 2 2 2
MIRT700912 PDXK pyridoxal kinase 2 2
MIRT701095 PAPOLG poly(A) polymerase gamma 2 2
MIRT701194 OTUD3 OTU deubiquitinase 3 2 2
MIRT702203 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT702272 LHX4 LIM homeobox 4 2 3
MIRT703125 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT703252 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT703262 GNL3L G protein nucleolar 3 like 2 2
MIRT703440 FYTTD1 forty-two-three domain containing 1 2 2
MIRT704321 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 2
MIRT704393 CTSS cathepsin S 2 2
MIRT704483 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT704880 CCSER2 coiled-coil serine rich protein 2 2 2
MIRT704926 CCDC36 coiled-coil domain containing 36 2 2
MIRT705175 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT706561 EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 2 2
MIRT707048 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT711497 PGD phosphogluconate dehydrogenase 2 2
MIRT716644 EPGN epithelial mitogen 2 2
MIRT720083 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT722288 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT725468 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4433a Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4433a Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-4433a Vincristine 5978 approved resistant cell line (W1)
hsa-mir-4433a Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4433a-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4433a-3p Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-4433a-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4433a-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-4433a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-4433a-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-4433a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4433a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission