pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4481 |
Genomic Coordinates | chr10: 12653138 - 12653197 |
Description | Homo sapiens miR-4481 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4481 | ||||||||||||
Sequence | 1| GGAGUGGGCUGGUGGUU |17 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | Illumina | ||||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | ASB16 | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | ankyrin repeat and SOCS box containing 16 | ||||||||||||||||||||
Transcript | NM_080863 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on ASB16 | |||||||||||||||||||||
3'UTR of ASB16 (miRNA target sites are highlighted) |
>ASB16|NM_080863|3'UTR 1 ACCCCATGTCAGGCTGTCCCATGGTGTGTTCTGCCCCTCCCACCTGTCCCCGCCTCCAACTGCGGAGGACCAGTTCCTGG 81 CCCTCTTTTCTTTTCTTTTTGAGACCTAGTCTCACTCTGTTGCCCAGGCTGGAGTGCAGTGGCGCTATCTCGGCTCACTG 161 CAACTTCTACCACCTAGGTTCAAGCGATTCTTGTGCCCCAAACTTCCGAGTAGCTGGGACTACAGGCATGAGTCACCACA 241 CCTGGCTGATTTTGTATTTTTAGTAGAGACAGGGTCTCACCATGTTGGCCAGGCTGGTCTCACACTGACCTCAGGTGATC 321 CACCCGCCTTGGCCTCCCAAAGTGTTGGGATTACAGGCATGAGCCACTGCGCCTGGTTGCCTGCCCCTCTTTTCTGTACT 401 CCACGTGCTGTCCTGGTCCACCTCACTCCTCCATGGGCTTCTTGAGACACCTGCTGACCTCTAGCCGGACCTGAGCTTCA 481 GACCCTCTCTCCAGCAGGAAGGGCTGCAGACTCGGCCTGTTCCCAGACTCGGCCTTCACCTCCCTTCTCCTCCTGTGTTT 561 AAGTGGATGGCCCCTCTATCCATCCAGGTCCCATGCCAAGAACCAGTGATTCTAGTGGCCCACCACCTCCCTCTCCTGCC 641 ACCCTTATACCTGTTCAGCCTCCTAAAGAGGGACAAACTCTGTCTCTGCGTGC Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Hela | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Cardiac Tissues |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM2202478. RNA binding protein: AGO2. Condition:S3_LV_36yo_Male_AGO2_bound_RNA
... - Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research. |
Article |
Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP.
- Spengler RM; Zhang X; Cheng C; McLendon JM; et al.- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
|
CLIP-seq Support 1 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000293414.1 | 3UTR | ACAUGUGCUGUGUCCACU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
84 hsa-miR-4481 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT100715 | TJAP1 | tight junction associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT183589 | ZC3H11A | zinc finger CCCH-type containing 11A | ![]() |
![]() |
2 | 2 | ||||||
MIRT338033 | DAZAP2 | DAZ associated protein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT395796 | SPCS3 | signal peptidase complex subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443947 | LRIT3 | leucine rich repeat, Ig-like and transmembrane domains 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450580 | HIST1H2BG | histone cluster 1 H2B family member g | ![]() |
![]() |
2 | 6 | ||||||
MIRT451617 | MEIS3P1 | Meis homeobox 3 pseudogene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452331 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453279 | EFTUD2 | elongation factor Tu GTP binding domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455212 | GNL1 | G protein nucleolar 1 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT455470 | LYPLA2 | lysophospholipase II | ![]() |
![]() |
2 | 2 | ||||||
MIRT456503 | PFKFB2 | 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456687 | LDB1 | LIM domain binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456915 | DDA1 | DET1 and DDB1 associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457603 | IDS | iduronate 2-sulfatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT457848 | RNASEH2B | ribonuclease H2 subunit B | ![]() |
![]() |
2 | 4 | ||||||
MIRT458455 | RPRM | reprimo, TP53 dependent G2 arrest mediator homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT460179 | UNK | unkempt family zinc finger | ![]() |
![]() |
2 | 6 | ||||||
MIRT461465 | SLC19A3 | solute carrier family 19 member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464739 | UBE2Q1 | ubiquitin conjugating enzyme E2 Q1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465279 | TRIM28 | tripartite motif containing 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468450 | SETD1B | SET domain containing 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT468620 | SUMO1 | small ubiquitin-like modifier 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT469152 | RNF121 | ring finger protein 121 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470073 | PTGES2 | prostaglandin E synthase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470172 | PSMD11 | proteasome 26S subunit, non-ATPase 11 | ![]() |
![]() |
2 | 4 | ||||||
MIRT473156 | MLLT1 | MLLT1, super elongation complex subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT474308 | LAMC1 | laminin subunit gamma 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474782 | KIAA0895L | KIAA0895 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT476484 | GATAD2A | GATA zinc finger domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT477613 | EFNA3 | ephrin A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479525 | CDCA4 | cell division cycle associated 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479973 | CARD10 | caspase recruitment domain family member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480410 | C19orf47 | chromosome 19 open reading frame 47 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480426 | C17orf85 | nuclear cap binding subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483573 | SYT2 | synaptotagmin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483664 | QSOX2 | quiescin sulfhydryl oxidase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT484532 | POLD3 | DNA polymerase delta 3, accessory subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT484616 | SIX3 | SIX homeobox 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT485897 | ZFP36 | ZFP36 ring finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT486505 | MYH11 | myosin heavy chain 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487505 | GRK5 | G protein-coupled receptor kinase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT488852 | UBTF | upstream binding transcription factor, RNA polymerase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT489464 | MSC | musculin | ![]() |
![]() |
2 | 2 | ||||||
MIRT491170 | LRP3 | LDL receptor related protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496627 | TMEM67 | transmembrane protein 67 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497616 | ANG | angiogenin | ![]() |
![]() |
2 | 2 | ||||||
MIRT497766 | KIAA0895 | KIAA0895 | ![]() |
![]() |
2 | 2 | ||||||
MIRT499680 | MRE11A | MRE11 homolog, double strand break repair nuclease | ![]() |
![]() |
2 | 6 | ||||||
MIRT499774 | SLC29A2 | solute carrier family 29 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT501745 | NSD1 | nuclear receptor binding SET domain protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT504995 | ZNF652 | zinc finger protein 652 | ![]() |
![]() |
2 | 2 | ||||||
MIRT511664 | HIST1H3C | histone cluster 1 H3 family member c | ![]() |
![]() |
2 | 2 | ||||||
MIRT511690 | HIST1H2BO | histone cluster 1 H2B family member o | ![]() |
![]() |
2 | 4 | ||||||
MIRT511703 | HIST1H2BL | histone cluster 1 H2B family member l | ![]() |
![]() |
2 | 4 | ||||||
MIRT511734 | HIST1H2BE | histone cluster 1 H2B family member e | ![]() |
![]() |
2 | 8 | ||||||
MIRT512858 | TBC1D13 | TBC1 domain family member 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT513444 | EMP1 | epithelial membrane protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT515681 | TFPI | tissue factor pathway inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT523529 | GLUL | glutamate-ammonia ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT525546 | PHB2 | prohibitin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT526209 | SNX24 | sorting nexin 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531554 | SRD5A1 | steroid 5 alpha-reductase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533764 | TMEM135 | transmembrane protein 135 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545582 | SNRPA1 | small nuclear ribonucleoprotein polypeptide A' | ![]() |
![]() |
2 | 2 | ||||||
MIRT552434 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561159 | BCL2L12 | BCL2 like 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562345 | EXOSC2 | exosome component 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570659 | KDM6B | lysine demethylase 6B | ![]() |
![]() |
2 | 2 | ||||||
MIRT571076 | TCHHL1 | trichohyalin like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571330 | TPCN2 | two pore segment channel 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571603 | TOB2 | transducer of ERBB2, 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573013 | RPP25 | ribonuclease P and MRP subunit p25 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609041 | EP300 | E1A binding protein p300 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613398 | DNAH17 | dynein axonemal heavy chain 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635589 | TTC9C | tetratricopeptide repeat domain 9C | ![]() |
![]() |
2 | 2 | ||||||
MIRT661118 | FPR1 | formyl peptide receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690103 | PNMA2 | paraneoplastic Ma antigen 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694972 | PLAC8 | placenta specific 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695515 | ALPI | alkaline phosphatase, intestinal | ![]() |
![]() |
2 | 2 | ||||||
MIRT695578 | ASB16 | ankyrin repeat and SOCS box containing 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699570 | SIT1 | signaling threshold regulating transmembrane adaptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701991 | MIER3 | MIER family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725464 | GRAP2 | GRB2-related adaptor protein 2 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|