pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-548t |
Genomic Coordinates | chr4: 173268160 - 173268233 |
Description | Homo sapiens miR-548t stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-548t-3p | |||||||||||||||||||||||||||||||||||
Sequence | 46| AAAAACCACAAUUACUUUUGCACCA |70 | |||||||||||||||||||||||||||||||||||
Evidence | Not_experimental | |||||||||||||||||||||||||||||||||||
Experiments | ||||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | BCAR1 | ||||||||||||||||||||
Synonyms | CAS, CAS1, CASS1, CRKAS, P130Cas | ||||||||||||||||||||
Description | BCAR1, Cas family scaffolding protein | ||||||||||||||||||||
Transcript | NM_001170714 | ||||||||||||||||||||
Other Transcripts | NM_001170715 , NM_001170716 , NM_001170717 , NM_001170718 , NM_001170719 , NM_001170720 , NM_001170721 , NM_014567 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on BCAR1 | |||||||||||||||||||||
3'UTR of BCAR1 (miRNA target sites are highlighted) |
>BCAR1|NM_001170714|3'UTR 1 GGGTGGTGACCCCAGGAGGGAGGCAGGGGAGGGGTGCGGCGGTCCCAGCTCCCTGGCTCCCATGTCAAGAGTCGCTGTGC 81 CACAGGCTTAGGGACAGGACCCCAGCTCTGCGTCGGTCCTGGTGCCCTGGATGCCCAGGAATCTGTATATATTTATGGCC 161 GGGCAGGGTGTGGGGCCATGCCTCCTCAGGAGCCGAAGCCCAGGGGCCGGCCAGTGGCCTTCCCCAGCATGCACCACGGG 241 CCCGGGTTGGGTCACCAGACGGGGCTGGAGTGTGAGGGTCCTGCAGCCTGCAGGACCTCGTGCCACCCCGAGGGCTGAGC 321 CTGGTCCCACGAGGGTGCCGTGTCCCCTGACAGGGCCAGTGCAGTTTGGTGTGTCCTCCGCCTTACCAGGAGAAGAACCT 401 GAAGAACTATTTTTCGTTATTGGTTTTCCAATCATTTGACTAAGAGTCTCCATTTAAATAAAGTTTTTAAAAGGAAGAGC 481 AAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Hela |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000162330.5 | 3UTR | GUUUUCCAAUCAUUUGACUAAGAGUCUCCAUUUAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
168 hsa-miR-548t-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT059365 | ANP32E | acidic nuclear phosphoprotein 32 family member E | ![]() |
![]() |
2 | 2 | ||||||
MIRT072839 | ARIH1 | ariadne RBR E3 ubiquitin protein ligase 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT076945 | PCGF2 | polycomb group ring finger 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT083941 | TFAP2C | transcription factor AP-2 gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT085401 | ETS2 | ETS proto-oncogene 2, transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT109790 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT114046 | AKAP11 | A-kinase anchoring protein 11 | ![]() |
![]() |
2 | 10 | ||||||
MIRT130165 | TXNIP | thioredoxin interacting protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT150013 | MIDN | midnolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT181258 | ASH1L | ASH1 like histone lysine methyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT205594 | NCL | nucleolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT222253 | ACTB | actin beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT245653 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT250947 | CDK5R1 | cyclin dependent kinase 5 regulatory subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT252497 | NWD1 | NACHT and WD repeat domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT271990 | ARF1 | ADP ribosylation factor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT280804 | RNF11 | ring finger protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT293803 | FEM1A | fem-1 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT318231 | RREB1 | ras responsive element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT341455 | ATP6V0B | ATPase H+ transporting V0 subunit b | ![]() |
![]() |
2 | 2 | ||||||
MIRT347413 | CEBPG | CCAAT/enhancer binding protein gamma | ![]() |
![]() |
2 | 4 | ||||||
MIRT351860 | PLEKHA3 | pleckstrin homology domain containing A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT357983 | GRPEL2 | GrpE like 2, mitochondrial | ![]() |
![]() |
2 | 2 | ||||||
MIRT377094 | PPP1CB | protein phosphatase 1 catalytic subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT407303 | IGFBP5 | insulin like growth factor binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441564 | LMOD3 | leiomodin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442364 | ZC3H12C | zinc finger CCCH-type containing 12C | ![]() |
![]() |
2 | 2 | ||||||
MIRT443228 | ARL5B | ADP ribosylation factor like GTPase 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT443404 | HMX3 | H6 family homeobox 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446055 | NR5A2 | nuclear receptor subfamily 5 group A member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448277 | ZNF652 | zinc finger protein 652 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450822 | KCNB1 | potassium voltage-gated channel subfamily B member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453016 | CCDC115 | coiled-coil domain containing 115 | ![]() |
![]() |
2 | 17 | ||||||
MIRT454463 | PPP2R2B | protein phosphatase 2 regulatory subunit Bbeta | ![]() |
![]() |
2 | 2 | ||||||
MIRT456360 | CITED2 | Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460007 | DNALI1 | dynein axonemal light intermediate chain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463154 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 6 | ||||||
MIRT463766 | YPEL2 | yippee like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468310 | SFT2D2 | SFT2 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470668 | POLR2D | RNA polymerase II subunit D | ![]() |
![]() |
2 | 4 | ||||||
MIRT478517 | CTTN | cortactin | ![]() |
![]() |
2 | 2 | ||||||
MIRT480507 | C11orf57 | chromosome 11 open reading frame 57 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484718 | INHBA | inhibin beta A subunit | ![]() |
![]() |
2 | 12 | ||||||
MIRT485494 | HMGN2 | high mobility group nucleosomal binding domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487302 | SLC38A9 | solute carrier family 38 member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487771 | ANKEF1 | ankyrin repeat and EF-hand domain containing 1 | ![]() |
![]() |
2 | 16 | ||||||
MIRT491876 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | ![]() |
![]() |
2 | 2 | ||||||
MIRT494304 | CEP120 | centrosomal protein 120 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495396 | TRIM24 | tripartite motif containing 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495646 | CDK1 | cyclin dependent kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496665 | TMEM237 | transmembrane protein 237 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496837 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498638 | CHD4 | chromodomain helicase DNA binding protein 4 | ![]() |
![]() |
2 | 10 | ||||||
MIRT503928 | FBXL13 | F-box and leucine rich repeat protein 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506063 | PPP2R2A | protein phosphatase 2 regulatory subunit Balpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT506582 | MIER3 | MIER family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506606 | MAT2A | methionine adenosyltransferase 2A | ![]() |
![]() |
2 | 4 | ||||||
MIRT506844 | KIF23 | kinesin family member 23 | ![]() |
![]() |
2 | 6 | ||||||
MIRT508536 | RPP14 | ribonuclease P/MRP subunit p14 | ![]() |
![]() |
2 | 4 | ||||||
MIRT509669 | ZNF354B | zinc finger protein 354B | ![]() |
![]() |
2 | 10 | ||||||
MIRT511170 | MBNL3 | muscleblind like splicing regulator 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512147 | COX6B1 | cytochrome c oxidase subunit 6B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512831 | ID4 | inhibitor of DNA binding 4, HLH protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT514558 | XRCC3 | X-ray repair cross complementing 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT515856 | AJAP1 | adherens junctions associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT521848 | PNISR | PNN interacting serine and arginine rich protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT525364 | SYNM | synemin | ![]() |
![]() |
2 | 2 | ||||||
MIRT527120 | ARHGAP15 | Rho GTPase activating protein 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527271 | FBLN2 | fibulin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527439 | COL4A3 | collagen type IV alpha 3 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT527658 | CD300E | CD300e molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT528334 | TBC1D22B | TBC1 domain family member 22B | ![]() |
![]() |
2 | 2 | ||||||
MIRT529033 | EXOC8 | exocyst complex component 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529321 | PDE5A | phosphodiesterase 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT529677 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529846 | SMTN | smoothelin | ![]() |
![]() |
2 | 2 | ||||||
MIRT530385 | ZNF431 | zinc finger protein 431 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530913 | GPR85 | G protein-coupled receptor 85 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531794 | KDR | kinase insert domain receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT532246 | KLF2 | Kruppel like factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT532658 | CBX7 | chromobox 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533630 | TMX3 | thioredoxin related transmembrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534811 | RAB33B | RAB33B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT534975 | PSD3 | pleckstrin and Sec7 domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536588 | ITPKB | inositol-trisphosphate 3-kinase B | ![]() |
![]() |
2 | 2 | ||||||
MIRT536779 | HNRNPD | heterogeneous nuclear ribonucleoprotein D | ![]() |
![]() |
2 | 2 | ||||||
MIRT538764 | CABLES1 | Cdk5 and Abl enzyme substrate 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539294 | ANGEL2 | angel homolog 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539621 | SHISA9 | shisa family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539651 | BUB1 | BUB1 mitotic checkpoint serine/threonine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT540347 | OPHN1 | oligophrenin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540413 | PITPNC1 | phosphatidylinositol transfer protein, cytoplasmic 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541396 | CDC27 | cell division cycle 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542916 | HSBP1 | heat shock factor binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544710 | EIF5A | eukaryotic translation initiation factor 5A | ![]() |
![]() |
2 | 4 | ||||||
MIRT544998 | MFF | mitochondrial fission factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT553289 | TSPAN3 | tetraspanin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553455 | TNRC6C | trinucleotide repeat containing 6C | ![]() |
![]() |
2 | 2 | ||||||
MIRT553782 | TAF13 | TATA-box binding protein associated factor 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554656 | ROBO1 | roundabout guidance receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555104 | PURB | purine rich element binding protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT557235 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560861 | GAL3ST3 | galactose-3-O-sulfotransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561545 | SON | SON DNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT561554 | SLMO2 | PRELI domain containing 3B | ![]() |
![]() |
2 | 2 | ||||||
MIRT563764 | ZNF678 | zinc finger protein 678 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565653 | SIX4 | SIX homeobox 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568080 | CELF2 | CUGBP Elav-like family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568759 | MYBL1 | MYB proto-oncogene like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569078 | CADM2 | cell adhesion molecule 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569509 | THYN1 | thymocyte nuclear protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571268 | CDKN2AIP | CDKN2A interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT571809 | PHF19 | PHD finger protein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572554 | DKK3 | dickkopf WNT signaling pathway inhibitor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573782 | SLC24A4 | solute carrier family 24 member 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT576441 | Ccdc115 | coiled-coil domain containing 115 | ![]() |
![]() |
2 | 10 | ||||||
MIRT576712 | Slc30a3 | solute carrier family 30 (zinc transporter), member 3 | ![]() |
![]() |
2 | 3 | ||||||
MIRT608377 | PIWIL2 | piwi like RNA-mediated gene silencing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608484 | NKTR | natural killer cell triggering receptor | ![]() |
![]() |
2 | 6 | ||||||
MIRT610186 | FAM49A | family with sequence similarity 49 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT611631 | EDIL3 | EGF like repeats and discoidin domains 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613534 | TRA2B | transformer 2 beta homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT616221 | PTPN11 | protein tyrosine phosphatase, non-receptor type 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622370 | SALL1 | spalt like transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624371 | CDK12 | cyclin dependent kinase 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624995 | ZNF665 | zinc finger protein 665 | ![]() |
![]() |
2 | 4 | ||||||
MIRT626875 | AP3B1 | adaptor related protein complex 3 beta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT627737 | RAP2B | RAP2B, member of RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT628490 | ADAT2 | adenosine deaminase, tRNA specific 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633647 | PLEKHG7 | pleckstrin homology and RhoGEF domain containing G7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT634028 | SLC30A3 | solute carrier family 30 member 3 | ![]() |
![]() |
2 | 3 | ||||||
MIRT635923 | GLTSCR2 | NOP53 ribosome biogenesis factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT638287 | SERBP1 | SERPINE1 mRNA binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641959 | RNF115 | ring finger protein 115 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643573 | CTNNA3 | catenin alpha 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645180 | NOL9 | nucleolar protein 9 | ![]() |
![]() |
2 | 4 | ||||||
MIRT647497 | ZNF639 | zinc finger protein 639 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647682 | PCK1 | phosphoenolpyruvate carboxykinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648422 | MYOZ3 | myozenin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650113 | ZCCHC9 | zinc finger CCHC-type containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651076 | ZNF518B | zinc finger protein 518B | ![]() |
![]() |
2 | 4 | ||||||
MIRT651415 | ZADH2 | zinc binding alcohol dehydrogenase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651456 | XKR4 | XK related 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653619 | SLC30A4 | solute carrier family 30 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653637 | SLC30A1 | solute carrier family 30 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654896 | POU2F1 | POU class 2 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656483 | MAP3K9 | mitogen-activated protein kinase kinase kinase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658016 | GABRA4 | gamma-aminobutyric acid type A receptor alpha4 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT658041 | FZD10 | frizzled class receptor 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660093 | BTBD3 | BTB domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663923 | MAGEF1 | MAGE family member F1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665882 | TGIF2 | TGFB induced factor homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669051 | CEP128 | centrosomal protein 128 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669711 | AAGAB | alpha and gamma adaptin binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT686812 | SNX2 | sorting nexin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT689883 | SOD2 | superoxide dismutase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693274 | GLRX2 | glutaredoxin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT697056 | BCAR1 | BCAR1, Cas family scaffolding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT703297 | GID4 | GID complex subunit 4 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT704087 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707719 | CDC6 | cell division cycle 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708136 | GK5 | glycerol kinase 5 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT709212 | KLHL30 | kelch like family member 30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710062 | RWDD2A | RWD domain containing 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT712770 | POU6F2 | POU class 6 homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715073 | TMTC1 | transmembrane and tetratricopeptide repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715387 | TADA3 | transcriptional adaptor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717712 | NCKAP1 | NCK associated protein 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|