miRTarBase - #MIRT700821


—
pre-miRNA Information
pre-miRNA hsa-mir-6819   
Genomic Coordinates chr22: 36286847 - 36286907
Description Homo sapiens miR-6819 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6819-3p
Sequence 41| AAGCCUCUGUCCCCACCCCAG |61
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1279530967 2 dbSNP
rs967579979 3 dbSNP
rs776891214 4 dbSNP
rs771166635 8 dbSNP
rs747037324 9 dbSNP
rs879248090 11 dbSNP
rs1485325191 12 dbSNP
rs778157316 16 dbSNP
Putative Targets

Gene Information
Gene Symbol PHLDA2   
Synonyms BRW1C, BWR1C, HLDA2, IPL, TSSC3
Description pleckstrin homology like domain family A member 2
Transcript NM_003311   
Expression
Putative miRNA Targets on PHLDA2
3'UTR of PHLDA2
(miRNA target sites are highlighted)		 
>PHLDA2|NM_003311|3'UTR
   1 GCCCGCCGCGGGCCATACGCTGGACGAGTCGGACCGAGGCTAGGACGTGGCCGGCGCTCTCCAGCCCTGCAGCAGAAGAA
  81 CTTCCCGTGCGCGCGGATCCTCGCTCCGTTGCACGGGCGCCTTAAGTTATTGGACTATCTAATATCTATGTATTTATTTC
 161 GCTGGTTCTTTGTAGTCACATATTTTATAGTCTTAATATCTTGTTTTTGCATCACTGTGCCCATTGCAAATAAATCACTT
 241 GGCCAGTTTGCTTTTCTACCATCCGGCTGTGGCTCAGTGAGACTCCTGCTGGGAGGGTGGAGGCCCAGGAATGGGCGGGC
 321 AGGACACCCTCATCCAGTCCTGCGGGGCTGGTGTGAAAGGCGCTGGGAACCGGCTTTGAATGAATAAATGAATCGTGTCA
 401 TCTGCAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacCCCACCCCUGUCUCCGAa 5'
             | ||  |||| |||||| 
Target 5' gacGAGT-CGGACCGAGGCTa 3'
 23 - 42 129.00 -14.30
2 
miRNA  3' gaccCCACC--CCUGUCUCCGaa 5'
              | |||  ||:::|||||  
Target 5' tcctGCTGGGAGGGTGGAGGCcc 3'
 284 - 306 123.00 -22.60
3 
miRNA  3' gaCCCCACC-C-CUGUCUCCGAa 5'
            ||| ||| | || ||: ||| 
Target 5' cgGGGCTGGTGTGAAAGGCGCTg 3'
 343 - 365 115.00 -16.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN29132576 128 COSMIC
COSN1131495 258 COSMIC
COSN6609073 275 COSMIC
COSN1528003 350 COSMIC
COSN26758018 605 COSMIC
COSN23988469 627 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs764245340 2 dbSNP
rs1199247133 7 dbSNP
rs1336135135 7 dbSNP
rs1248387213 8 dbSNP
rs925742769 10 dbSNP
rs1389631336 12 dbSNP
rs1198135911 13 dbSNP
rs558993627 15 dbSNP
rs780442733 16 dbSNP
rs945763216 17 dbSNP
rs1156540826 19 dbSNP
rs1383731760 23 dbSNP
rs1400507914 24 dbSNP
rs912924956 32 dbSNP
rs753174881 34 dbSNP
rs1481882880 38 dbSNP
rs1282782378 40 dbSNP
rs765490981 45 dbSNP
rs763184811 47 dbSNP
rs1266498514 49 dbSNP
rs200896318 50 dbSNP
rs1029443155 55 dbSNP
rs1466622116 57 dbSNP
rs979963482 62 dbSNP
rs1252394543 63 dbSNP
rs956298044 85 dbSNP
rs1179313553 88 dbSNP
rs1362869377 92 dbSNP
rs1472921329 96 dbSNP
rs1164261606 97 dbSNP
rs1435102479 98 dbSNP
rs952630860 106 dbSNP
rs1371661202 108 dbSNP
rs953068454 109 dbSNP
rs1031730513 113 dbSNP
rs1027753619 122 dbSNP
rs994911317 124 dbSNP
rs1245765507 128 dbSNP
rs897897368 128 dbSNP
rs904486227 129 dbSNP
rs1044455620 134 dbSNP
rs1483958082 139 dbSNP
rs550226914 146 dbSNP
rs896101035 153 dbSNP
rs929436877 154 dbSNP
rs1250523326 156 dbSNP
rs1189154392 158 dbSNP
rs538013101 165 dbSNP
rs752986329 174 dbSNP
rs1443193914 177 dbSNP
rs1163275680 184 dbSNP
rs1008847673 189 dbSNP
rs1432152082 194 dbSNP
rs890723771 197 dbSNP
rs1395819201 198 dbSNP
rs1313578201 204 dbSNP
rs1301449772 212 dbSNP
rs1396638446 214 dbSNP
rs1336424984 220 dbSNP
rs1051091511 221 dbSNP
rs932181691 222 dbSNP
rs1218289147 223 dbSNP
rs1368082766 234 dbSNP
rs904715996 237 dbSNP
rs1043212129 240 dbSNP
rs781745396 243 dbSNP
rs567502188 244 dbSNP
rs549191436 249 dbSNP
rs1250308559 255 dbSNP
rs1201626732 258 dbSNP
rs1332824054 260 dbSNP
rs945817119 263 dbSNP
rs1183424333 268 dbSNP
rs1400274825 272 dbSNP
rs912978695 274 dbSNP
rs1056819 275 dbSNP
rs1168987638 280 dbSNP
rs10582 281 dbSNP
rs1466627573 287 dbSNP
rs200466299 289 dbSNP
rs927251341 294 dbSNP
rs980399477 296 dbSNP
rs952647134 299 dbSNP
rs1367055608 304 dbSNP
rs567045646 309 dbSNP
rs778967589 309 dbSNP
rs1294803839 314 dbSNP
rs551311316 315 dbSNP
rs1234791048 317 dbSNP
rs1260687322 318 dbSNP
rs972539111 319 dbSNP
rs932556576 321 dbSNP
rs962137480 324 dbSNP
rs1269579013 332 dbSNP
rs749978736 333 dbSNP
rs1466547546 334 dbSNP
rs1452832201 340 dbSNP
rs563296393 354 dbSNP
rs1179385722 358 dbSNP
rs1440216447 367 dbSNP
rs755113607 370 dbSNP
rs976653891 376 dbSNP
rs1008869086 377 dbSNP
rs954842364 386 dbSNP
rs1028979850 388 dbSNP
rs1160223953 389 dbSNP
rs1391050126 393 dbSNP
rs1194008217 405 dbSNP
rs996853997 407 dbSNP
rs532813465 415 dbSNP
rs1043280012 417 dbSNP
rs1031927996 420 dbSNP
rs1388421146 421 dbSNP
rs764789779 425 dbSNP
rs1209653267 465 dbSNP
rs891553052 468 dbSNP
rs1228415052 469 dbSNP
rs969243379 471 dbSNP
rs1056878668 473 dbSNP
rs562768788 474 dbSNP
rs1214175007 481 dbSNP
rs1260494593 485 dbSNP
rs1310783248 486 dbSNP
rs1240310966 488 dbSNP
rs1335681328 493 dbSNP
rs926982043 494 dbSNP
rs1414476936 496 dbSNP
rs115215816 510 dbSNP
rs753473745 511 dbSNP
rs919847567 513 dbSNP
rs1158165870 515 dbSNP
rs972550976 518 dbSNP
rs374662530 520 dbSNP
rs1035915954 521 dbSNP
rs558408518 523 dbSNP
rs1364824706 524 dbSNP
rs574012320 532 dbSNP
rs561861534 534 dbSNP
rs75881889 536 dbSNP
rs80068504 537 dbSNP
rs907976061 544 dbSNP
rs61871194 551 dbSNP
rs1159318790 552 dbSNP
rs1222829767 553 dbSNP
rs1306786944 555 dbSNP
rs987542507 561 dbSNP
rs954797418 565 dbSNP
rs540472597 567 dbSNP
rs1056832 568 dbSNP
rs1248561888 569 dbSNP
rs1290240448 572 dbSNP
rs996183042 572 dbSNP
rs114660250 576 dbSNP
rs1234662232 590 dbSNP
rs1425514247 595 dbSNP
rs1479802602 599 dbSNP
rs1176867718 600 dbSNP
rs553976538 604 dbSNP
rs1021845418 609 dbSNP
rs1384604238 610 dbSNP
rs1430316885 623 dbSNP
rs1038313904 628 dbSNP
rs1352230185 629 dbSNP
rs1187019212 632 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaccCCACCCCUGUCUCCGAa 5'
              ||  | |:| |: ||| 
Target 5' ---aGGACGUGGCCGGCGCUc 3'
 		1 - 18
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000314222.4 | 3UTR | AGGACGUGGCCGGCGCUCUCCAGCCCUGCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-6819-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT358318 PANK3 pantothenate kinase 3 2 2
MIRT454719 UBQLNL ubiquilin like 2 2
MIRT471362 PEG10 paternally expressed 10 2 2
MIRT478101 DLG5 discs large MAGUK scaffold protein 5 2 4
MIRT495554 GOLGA6L4 golgin A6 family-like 4 2 2
MIRT495587 GOLGA6L10 golgin A6 family-like 10 2 2
MIRT508315 RPL18 ribosomal protein L18 2 4
MIRT529183 ADAM33 ADAM metallopeptidase domain 33 2 2
MIRT532035 FHDC1 FH2 domain containing 1 2 2
MIRT545131 ANXA5 annexin A5 2 2
MIRT567288 HNRNPL heterogeneous nuclear ribonucleoprotein L 2 2
MIRT568094 CEBPG CCAAT/enhancer binding protein gamma 2 2
MIRT573291 DLX4 distal-less homeobox 4 2 2
MIRT575169 Fam120c family with sequence similarity 120, member C 2 2
MIRT609495 DNASE1L3 deoxyribonuclease 1 like 3 2 2
MIRT611264 EHD3 EH domain containing 3 2 2
MIRT613580 POC5 POC5 centriolar protein 2 2
MIRT616520 C9orf170 chromosome 9 open reading frame 170 2 2
MIRT617098 ZNF667 zinc finger protein 667 2 2
MIRT618268 DDX51 DEAD-box helicase 51 2 2
MIRT618294 ZNF682 zinc finger protein 682 2 2
MIRT618617 SHOX short stature homeobox 2 2
MIRT619741 SRFBP1 serum response factor binding protein 1 2 2
MIRT619784 NRIP2 nuclear receptor interacting protein 2 2 2
MIRT621119 SP110 SP110 nuclear body protein 2 2
MIRT622530 RAD51 RAD51 recombinase 2 2
MIRT623088 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT623938 FKBP14 FK506 binding protein 14 2 2
MIRT624389 CD84 CD84 molecule 2 2
MIRT624860 ABI2 abl interactor 2 2 2
MIRT628752 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT632243 VTA1 vesicle trafficking 1 2 2
MIRT632987 E2F2 E2F transcription factor 2 2 2
MIRT633695 RBM43 RNA binding motif protein 43 2 2
MIRT633766 CENPBD1 CENPB DNA-binding domain containing 1 2 2
MIRT633808 ZNF91 zinc finger protein 91 2 2
MIRT638914 CBLN2 cerebellin 2 precursor 2 2
MIRT641298 SLAMF1 signaling lymphocytic activation molecule family member 1 2 2
MIRT642123 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT642179 HEBP2 heme binding protein 2 2 2
MIRT642617 CDKN3 cyclin dependent kinase inhibitor 3 2 2
MIRT643325 TMEM151B transmembrane protein 151B 2 2
MIRT644534 TMEM134 transmembrane protein 134 2 2
MIRT645820 OMA1 OMA1 zinc metallopeptidase 2 2
MIRT646093 MGST3 microsomal glutathione S-transferase 3 2 2
MIRT646861 SLC35E4 solute carrier family 35 member E4 2 2
MIRT647466 DZIP1L DAZ interacting zinc finger protein 1 like 2 2
MIRT647702 NADSYN1 NAD synthetase 1 2 2
MIRT648082 ZMIZ2 zinc finger MIZ-type containing 2 2 2
MIRT648547 TMEM169 transmembrane protein 169 2 2
MIRT648690 AP1M1 adaptor related protein complex 1 mu 1 subunit 2 2
MIRT649747 GNB5 G protein subunit beta 5 2 2
MIRT650154 ZNF426 zinc finger protein 426 2 2
MIRT650450 CPXM2 carboxypeptidase X, M14 family member 2 2 2
MIRT650943 CTNS cystinosin, lysosomal cystine transporter 2 2
MIRT651544 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT652304 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT652890 SYVN1 synoviolin 1 2 2
MIRT654222 RNF19B ring finger protein 19B 2 2
MIRT654676 PSMB5 proteasome subunit beta 5 2 2
MIRT658249 FAXC failed axon connections homolog 2 2
MIRT658363 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT659622 CELF1 CUGBP Elav-like family member 1 2 2
MIRT660171 BNIP3L BCL2 interacting protein 3 like 2 2
MIRT660634 ANKRD52 ankyrin repeat domain 52 2 2
MIRT662428 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT662984 PAK3 p21 (RAC1) activated kinase 3 2 2
MIRT663939 ZNF554 zinc finger protein 554 2 2
MIRT666960 PKHD1 PKHD1, fibrocystin/polyductin 2 2
MIRT667945 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 2
MIRT668847 CYCS cytochrome c, somatic 2 2
MIRT671792 RGS17 regulator of G protein signaling 17 2 2
MIRT672382 RPL37 ribosomal protein L37 2 2
MIRT673516 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 4
MIRT674716 FAM73A mitoguardin 1 2 2
MIRT676352 KLF8 Kruppel like factor 8 2 2
MIRT677820 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT678440 PDE4C phosphodiesterase 4C 2 2
MIRT678499 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT679243 LRP10 LDL receptor related protein 10 2 2
MIRT693607 SLC39A1 solute carrier family 39 member 1 2 2
MIRT695927 ZNF174 zinc finger protein 174 2 2
MIRT697987 TSPAN6 tetraspanin 6 2 2
MIRT700821 PHLDA2 pleckstrin homology like domain family A member 2 2 2
MIRT701350 NR4A3 nuclear receptor subfamily 4 group A member 3 2 2
MIRT702348 KLHL7 kelch like family member 7 2 2
MIRT703387 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT703883 ERBB2IP erbb2 interacting protein 2 2
MIRT708237 PPP1R26 protein phosphatase 1 regulatory subunit 26 2 2
MIRT708629 NUDT18 nudix hydrolase 18 2 2
MIRT708990 CABP4 calcium binding protein 4 2 2
MIRT709804 FOXE1 forkhead box E1 2 2
MIRT710203 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT710248 VAMP1 vesicle associated membrane protein 1 2 2
MIRT710281 FGF1 fibroblast growth factor 1 2 2
MIRT712992 IRGQ immunity related GTPase Q 2 2
MIRT713887 MOB3A MOB kinase activator 3A 2 2
MIRT715600 ADAM17 ADAM metallopeptidase domain 17 2 2
MIRT715639 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT715686 FRK fyn related Src family tyrosine kinase 2 2
MIRT717053 WIZ widely interspaced zinc finger motifs 2 2
MIRT717611 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT721539 DKK3 dickkopf WNT signaling pathway inhibitor 3 2 2
MIRT722096 SUSD1 sushi domain containing 1 2 2
MIRT722435 HRNR hornerin 2 2
MIRT722855 NEGR1 neuronal growth regulator 1 2 2
MIRT724621 SNAP25 synaptosome associated protein 25 2 2
MIRT724777 PSG4 pregnancy specific beta-1-glycoprotein 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6819 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6819-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-6819-3p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-6819-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-6819-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-6819-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6819-3p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-6819-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission