pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6132 |
Genomic Coordinates | chr7: 117020211 - 117020319 |
Description | Homo sapiens miR-6132 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6132 | |||||||||||||||
Sequence | 21| AGCAGGGCUGGGGAUUGCA |39 | |||||||||||||||
Evidence | Experimental | |||||||||||||||
Experiments | Illumina | |||||||||||||||
SNPs in miRNA |
|
|||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | NUP35 | ||||||||||||||||||||
Synonyms | MP-44, MP44, NP44, NUP53 | ||||||||||||||||||||
Description | nucleoporin 35 | ||||||||||||||||||||
Transcript | NM_138285 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on NUP35 | |||||||||||||||||||||
3'UTR of NUP35 (miRNA target sites are highlighted) |
>NUP35|NM_138285|3'UTR 1 TAGAACACCAAGAAGGAGGTTGCTACACTAAAACAGAGTTAGCAGAGTGCTGCTGGTTCCTTCGGTTAGTTATATAACTG 81 TTCCTGCAGTATTGGATAGCTATCTCATACTTCTTTTAGAAAGAAGCCTTTTTCATTAAGGATACAACCTATTTGTAGCT 161 CGCACTTTAAAAGATGCTTGAGATACATTTTAAAGAAAACTAAAAATCCCTGTAAATAGGATTTTGTGCTTTCTGTAACA 241 GTGCATGCTTCAGCACAGAAAACTCAGCATTGATTATTGTAAATTAAATAACTGAAATTGTGGTGAGACGTCATAGTCTT 321 CATGAGAACGTGGGGGTGAATTTCATGAAGGGGAACTATAGTTATTTCTACCGACACAAATATTATAATTAGCAATTTGA 401 ATTATGGTCTTTTAATTTAGATAGTATTTAATATTTTAATTATCCTTGTTTGTATATGTCCTGTCACAGAGTGTCCTCTT 481 GGTGTATTCTAAAACGAGCATTCTTTTAAAAAACCTAAAGTTTCTTGATAATAAACATTGTCAATGATATGTG Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Hela | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000295119.4 | 3UTR | AGUGCAGUGGUGCGAUCUUGGCUCCCUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
82 hsa-miR-6132 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT067294 | NECAP1 | NECAP endocytosis associated 1 | ![]() |
![]() |
2 | 10 | ||||||
MIRT100110 | ABT1 | activator of basal transcription 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT358583 | CANX | calnexin | ![]() |
![]() |
2 | 2 | ||||||
MIRT445247 | SEMA5A | semaphorin 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT445764 | CCND3 | cyclin D3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452388 | LY6E | lymphocyte antigen 6 family member E | ![]() |
![]() |
2 | 4 | ||||||
MIRT452829 | FAM131B | family with sequence similarity 131 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT453450 | GLG1 | golgi glycoprotein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455435 | ID3 | inhibitor of DNA binding 3, HLH protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT460629 | IGFBP4 | insulin like growth factor binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461607 | DPH2 | DPH2 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT461989 | PACSIN1 | protein kinase C and casein kinase substrate in neurons 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464258 | VCL | vinculin | ![]() |
![]() |
2 | 2 | ||||||
MIRT465713 | TNFAIP1 | TNF alpha induced protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466475 | TECPR2 | tectonin beta-propeller repeat containing 2 | ![]() |
![]() |
2 | 7 | ||||||
MIRT467119 | SRGAP1 | SLIT-ROBO Rho GTPase activating protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT468299 | SFT2D2 | SFT2 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469696 | RAB5B | RAB5B, member RAS oncogene family | ![]() |
![]() |
2 | 8 | ||||||
MIRT469904 | PTRF | caveolae associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470015 | PTPLB | 3-hydroxyacyl-CoA dehydratase 2 | ![]() |
1 | 1 | |||||||
MIRT471385 | PDPR | pyruvate dehydrogenase phosphatase regulatory subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT471409 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471719 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT473608 | MARK2 | microtubule affinity regulating kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476328 | GLTSCR1L | BRD4 interacting chromatin remodeling complex associated protein like | ![]() |
![]() |
2 | 2 | ||||||
MIRT479448 | CDK6 | cyclin dependent kinase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482032 | AMER1 | APC membrane recruitment protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482360 | AGO2 | argonaute 2, RISC catalytic component | ![]() |
![]() |
2 | 2 | ||||||
MIRT484661 | HOXD3 | homeobox D3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT486828 | NDOR1 | NADPH dependent diflavin oxidoreductase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487069 | CLASP1 | cytoplasmic linker associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT487196 | NFASC | neurofascin | ![]() |
![]() |
2 | 4 | ||||||
MIRT487448 | TFAP2B | transcription factor AP-2 beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT487517 | GXYLT2 | glucoside xylosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487640 | BRSK2 | BR serine/threonine kinase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT487755 | SKI | SKI proto-oncogene | ![]() |
![]() |
2 | 4 | ||||||
MIRT489944 | CPLX1 | complexin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491101 | MSI1 | musashi RNA binding protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT491181 | LAMA5 | laminin subunit alpha 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492355 | SEMA7A | semaphorin 7A (John Milton Hagen blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT493918 | FAM127B | retrotransposon Gag like 8A | ![]() |
![]() |
2 | 4 | ||||||
MIRT493932 | FAM127A | retrotransposon Gag like 8C | ![]() |
![]() |
2 | 4 | ||||||
MIRT494679 | ARID3A | AT-rich interaction domain 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT494814 | AKAP11 | A-kinase anchoring protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT494835 | ADCY9 | adenylate cyclase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495455 | PNMAL2 | paraneoplastic Ma antigen family member 8B | ![]() |
![]() |
2 | 2 | ||||||
MIRT496962 | MAP1LC3B | microtubule associated protein 1 light chain 3 beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT526228 | MTRNR2L5 | MT-RNR2-like 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531028 | TDGF1P3 | teratocarcinoma-derived growth factor 1 pseudogene 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557110 | HOXA3 | homeobox A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560514 | POGK | pogo transposable element derived with KRAB domain | ![]() |
![]() |
2 | 2 | ||||||
MIRT567753 | DLC1 | DLC1 Rho GTPase activating protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT569608 | TRIM29 | tripartite motif containing 29 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570242 | CPNE5 | copine 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572327 | HSPB6 | heat shock protein family B (small) member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572373 | ATOX1 | antioxidant 1 copper chaperone | ![]() |
![]() |
2 | 2 | ||||||
MIRT575024 | Tecpr2 | tectonin beta-propeller repeat containing 2 | ![]() |
![]() |
2 | 5 | ||||||
MIRT576146 | Hmox1 | heme oxygenase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT612443 | SMOC2 | SPARC related modular calcium binding 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615404 | VDAC2 | voltage dependent anion channel 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629114 | CYCS | cytochrome c, somatic | ![]() |
![]() |
2 | 2 | ||||||
MIRT631362 | FOXI2 | forkhead box I2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639322 | THBD | thrombomodulin | ![]() |
![]() |
2 | 2 | ||||||
MIRT643797 | ABCC12 | ATP binding cassette subfamily C member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669687 | ABLIM1 | actin binding LIM protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670595 | LLGL1 | LLGL1, scribble cell polarity complex component | ![]() |
![]() |
2 | 4 | ||||||
MIRT691190 | NIF3L1 | NGG1 interacting factor 3 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691688 | FLOT2 | flotillin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697127 | OTUD5 | OTU deubiquitinase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700814 | PHLDA2 | pleckstrin homology like domain family A member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701248 | NUP35 | nucleoporin 35 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702362 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703325 | GDPD5 | glycerophosphodiester phosphodiesterase domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706060 | PKD1 | polycystin 1, transient receptor potential channel interacting | ![]() |
![]() |
2 | 2 | ||||||
MIRT710475 | CDH5 | cadherin 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713018 | SLC4A2 | solute carrier family 4 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716427 | RAB15 | RAB15, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT718093 | ABHD12 | abhydrolase domain containing 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718542 | PIGQ | phosphatidylinositol glycan anchor biosynthesis class Q | ![]() |
![]() |
2 | 2 | ||||||
MIRT719122 | CACFD1 | calcium channel flower domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721393 | LDLRAD4 | low density lipoprotein receptor class A domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT736283 | CDC42 | cell division cycle 42 | ![]() |
![]() |
2 | 0 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|