pre-miRNA Information
pre-miRNA hsa-mir-7107   
Genomic Coordinates chr12: 121444273 - 121444352
Description Homo sapiens miR-7107 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7107-5p
Sequence 6| UCGGCCUGGGGAGGAGGAAGGG |27
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs782634189 2 dbSNP
rs782536354 3 dbSNP
rs1230027540 4 dbSNP
rs539127530 5 dbSNP
rs782765349 9 dbSNP
rs55671311 10 dbSNP
rs183760300 11 dbSNP
rs782805318 12 dbSNP
rs782108772 19 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MRPL37   
Synonyms L2mt, L37mt, MRP-L2, MRP-L37, MRPL2, RPML2
Description mitochondrial ribosomal protein L37
Transcript NM_016491   
Expression
Putative miRNA Targets on MRPL37
3'UTR of MRPL37
(miRNA target sites are highlighted)
>MRPL37|NM_016491|3'UTR
   1 GCGGAGGACCCCTCTGAATCCTGAAACCCCTCTTGCCTCTCTTCCACGGAAGAGGGCCTGGGCCCCGTGGAGCCTCAGTG
  81 CCCGTTTGGCCTGCTGCTCTCGCTGACAATAAAGAGCCCTTGCGTTGCACTGAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ggGA-AGGAGGAG---------GGGUCCGGcu 5'
            || ||:||| |         ||::||||  
Target 5' gcCTCTCTTCCACGGAAGAGGGCCTGGGCCcc 3'
35 - 66 104.00 -24.60
2
miRNA  3' ggGAA--GGAGGAGGGGUCCGGCu 5'
            :||  ||| || |:|  ||:| 
Target 5' cgTTTGGCCTGCTGCTCTCGCTGa 3'
83 - 106 86.00 -18.70
3
miRNA  3' gggaAGGA----GGAGGGGUCCGGcu 5'
              ||||    || ||:|  |||  
Target 5' tgaaTCCTGAAACC-CCTCTTGCCtc 3'
15 - 39 75.00 -16.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN503912 4 COSMIC
COSN30147470 24 COSMIC
COSN30151898 33 COSMIC
COSN7052374 40 COSMIC
COSN28843761 48 COSMIC
COSN31494949 51 COSMIC
COSN31612815 63 COSMIC
COSN30492961 68 COSMIC
COSN30139204 85 COSMIC
COSN30518824 94 COSMIC
COSN30518830 95 COSMIC
COSN31511460 119 COSMIC
COSN30117623 121 COSMIC
COSN26985063 125 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs764830454 2 dbSNP
rs148209374 3 dbSNP
rs6621 4 dbSNP
rs1484781242 10 dbSNP
rs763894770 11 dbSNP
rs751533561 21 dbSNP
rs1266103117 23 dbSNP
rs943553531 27 dbSNP
rs1284097089 28 dbSNP
rs533397409 33 dbSNP
rs549872566 48 dbSNP
rs746084904 49 dbSNP
rs368651967 58 dbSNP
rs921041345 64 dbSNP
rs931037461 66 dbSNP
rs1062675 67 dbSNP
rs35021811 68 dbSNP
rs555053379 74 dbSNP
rs1397222183 79 dbSNP
rs965855045 80 dbSNP
rs373173369 84 dbSNP
rs566317874 85 dbSNP
rs939936503 90 dbSNP
rs1472038418 91 dbSNP
rs1200673303 97 dbSNP
rs777884274 102 dbSNP
rs575999835 103 dbSNP
rs1444136237 124 dbSNP
rs906456526 125 dbSNP
rs967916782 126 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' gggaaggaggaggggUCCGGCu 5'
                         |||||| 
Target 5' -----gcauuuugggAGGCCGa 3'
1 - 17
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000487429.1 | 3UTR | GCAUUUUGGGAGGCCGAGGCGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
144 hsa-miR-7107-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT060580 CCND1 cyclin D1 2 4
MIRT451035 ZNF610 zinc finger protein 610 2 2
MIRT485711 CASP16 caspase 16, pseudogene 2 8
MIRT488402 TDRKH tudor and KH domain containing 2 2
MIRT492084 TCF21 transcription factor 21 2 2
MIRT504213 VAV3 vav guanine nucleotide exchange factor 3 2 13
MIRT505723 SERTAD3 SERTA domain containing 3 2 4
MIRT509007 FBXO6 F-box protein 6 2 2
MIRT509843 FOS Fos proto-oncogene, AP-1 transcription factor subunit 2 2
MIRT514761 RBM4B RNA binding motif protein 4B 2 2
MIRT515664 LRRC27 leucine rich repeat containing 27 2 2
MIRT516316 F8A2 coagulation factor VIII associated 2 2 2
MIRT516342 F8A3 coagulation factor VIII associated 3 2 2
MIRT517139 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT518746 C1orf35 chromosome 1 open reading frame 35 2 2
MIRT519299 MLH1 mutL homolog 1 2 2
MIRT521527 QSOX1 quiescin sulfhydryl oxidase 1 2 4
MIRT531756 TXK TXK tyrosine kinase 2 2
MIRT542208 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT542235 FUT9 fucosyltransferase 9 2 2
MIRT542791 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT554378 SETD5 SET domain containing 5 2 2
MIRT569908 PCSK9 proprotein convertase subtilisin/kexin type 9 2 2
MIRT570222 SLC27A1 solute carrier family 27 member 1 2 2
MIRT570976 RGS19 regulator of G protein signaling 19 2 2
MIRT573046 SHMT1 serine hydroxymethyltransferase 1 2 2
MIRT574954 Vav3 vav 3 oncogene 2 8
MIRT609297 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT612990 GBX2 gastrulation brain homeobox 2 2 2
MIRT613851 SHB SH2 domain containing adaptor protein B 2 2
MIRT613935 POLR3A RNA polymerase III subunit A 2 2
MIRT614243 WDR53 WD repeat domain 53 2 4
MIRT615158 SPIB Spi-B transcription factor 2 2
MIRT616145 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT616389 C1orf87 chromosome 1 open reading frame 87 2 2
MIRT617737 ATCAY ATCAY, caytaxin 2 4
MIRT621449 TCN2 transcobalamin 2 2 2
MIRT625784 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 2 2
MIRT628556 MELK maternal embryonic leucine zipper kinase 2 2
MIRT632041 ZNF430 zinc finger protein 430 2 2
MIRT634937 GTF2H2C GTF2H2 family member C 2 4
MIRT637208 MEAF6 MYST/Esa1 associated factor 6 2 2
MIRT637610 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT637832 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT638107 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT638387 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT641689 SPCS1 signal peptidase complex subunit 1 2 2
MIRT642611 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT643850 LACTB lactamase beta 2 4
MIRT649575 PALD1 phosphatase domain containing, paladin 1 2 2
MIRT649860 WDR12 WD repeat domain 12 2 2
MIRT651026 ZNF699 zinc finger protein 699 2 2
MIRT652336 TMOD3 tropomodulin 3 2 4
MIRT653286 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 2 2
MIRT656292 METTL14 methyltransferase like 14 2 2
MIRT656458 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT659539 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 2 2
MIRT661537 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT668042 GTPBP10 GTP binding protein 10 2 2
MIRT668147 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT668800 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT669818 STOML1 stomatin like 1 2 2
MIRT670490 DCUN1D2 defective in cullin neddylation 1 domain containing 2 2 2
MIRT670615 NPHP1 nephrocystin 1 2 2
MIRT670892 CYTIP cytohesin 1 interacting protein 2 2
MIRT670943 LIPG lipase G, endothelial type 2 2
MIRT671268 MTRNR2L5 MT-RNR2-like 5 2 2
MIRT671903 GBP4 guanylate binding protein 4 2 2
MIRT672239 ABHD15 abhydrolase domain containing 15 2 2
MIRT672326 C9orf3 chromosome 9 open reading frame 3 2 2
MIRT673113 MFSD2A major facilitator superfamily domain containing 2A 2 2
MIRT674412 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT677718 IRF1 interferon regulatory factor 1 2 2
MIRT678585 PPP1R3B protein phosphatase 1 regulatory subunit 3B 2 2
MIRT678726 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT679338 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT679614 RRP36 ribosomal RNA processing 36 2 2
MIRT679695 SLC1A5 solute carrier family 1 member 5 2 4
MIRT679715 RPL24 ribosomal protein L24 2 2
MIRT680065 CD96 CD96 molecule 2 2
MIRT683379 ESR2 estrogen receptor 2 2 2
MIRT683683 MICA MHC class I polypeptide-related sequence A 2 2
MIRT683865 OCIAD1 OCIA domain containing 1 2 2
MIRT684073 TLR7 toll like receptor 7 2 2
MIRT684126 CEP104 centrosomal protein 104 2 2
MIRT684485 GPR137B G protein-coupled receptor 137B 2 2
MIRT684736 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT684778 MYO1F myosin IF 2 2
MIRT685028 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT685189 DCTN5 dynactin subunit 5 2 2
MIRT685307 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT685514 MSH3 mutS homolog 3 2 2
MIRT685702 BHMT2 betaine--homocysteine S-methyltransferase 2 2 2
MIRT685944 PTGIS prostaglandin I2 synthase 2 2
MIRT686311 VPS53 VPS53, GARP complex subunit 2 2
MIRT686686 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT687641 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT687923 HOOK3 hook microtubule tethering protein 3 2 2
MIRT688117 GEMIN8 gem nuclear organelle associated protein 8 2 2
MIRT688460 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 2 2
MIRT688629 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT688823 CAPZA2 capping actin protein of muscle Z-line alpha subunit 2 2 2
MIRT689117 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT689166 ZNF665 zinc finger protein 665 2 2
MIRT690070 MBD1 methyl-CpG binding domain protein 1 2 2
MIRT690733 IRAK4 interleukin 1 receptor associated kinase 4 2 2
MIRT691324 KIAA1841 KIAA1841 2 2
MIRT691517 ZNF682 zinc finger protein 682 2 2
MIRT691607 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT692314 RFK riboflavin kinase 2 2
MIRT692376 LY6G5B lymphocyte antigen 6 family member G5B 2 2
MIRT692436 METTL8 methyltransferase like 8 2 2
MIRT692782 SYNPO2L synaptopodin 2 like 2 2
MIRT693136 THEM4 thioesterase superfamily member 4 2 2
MIRT693422 TECPR2 tectonin beta-propeller repeat containing 2 2 2
MIRT693871 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT694049 PRIM1 DNA primase subunit 1 2 2
MIRT694092 KIAA0930 KIAA0930 2 2
MIRT694190 ZNF347 zinc finger protein 347 2 2
MIRT695177 SLC25A33 solute carrier family 25 member 33 2 2
MIRT696180 GNB5 G protein subunit beta 5 2 2
MIRT697387 ZMAT3 zinc finger matrin-type 3 2 2
MIRT698924 SPEM1 spermatid maturation 1 2 2
MIRT699314 SLC35F5 solute carrier family 35 member F5 2 4
MIRT701106 PAPD5 poly(A) RNA polymerase D5, non-canonical 2 2
MIRT701575 MYPN myopalladin 2 2
MIRT701825 MRPL37 mitochondrial ribosomal protein L37 2 2
MIRT702047 METTL21A methyltransferase like 21A 2 2
MIRT703034 HAS2 hyaluronan synthase 2 2 4
MIRT704143 DNAL1 dynein axonemal light chain 1 2 2
MIRT704759 CDKN2AIPNL CDKN2A interacting protein N-terminal like 2 2
MIRT705079 C4orf29 abhydrolase domain containing 18 2 2
MIRT705346 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT706104 ENTPD4 ectonucleoside triphosphate diphosphohydrolase 4 2 2
MIRT709070 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT709534 ZBED1 zinc finger BED-type containing 1 2 2
MIRT712356 NAT14 N-acetyltransferase 14 (putative) 2 2
MIRT713713 PAOX polyamine oxidase 2 2
MIRT714304 ZNF454 zinc finger protein 454 2 2
MIRT714919 PPP1R12C protein phosphatase 1 regulatory subunit 12C 2 2
MIRT715792 TBL3 transducin beta like 3 2 2
MIRT717376 RBM41 RNA binding motif protein 41 2 2
MIRT719069 ACOX1 acyl-CoA oxidase 1 2 2
MIRT724548 HAUS2 HAUS augmin like complex subunit 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-7107-5p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-7107-5p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-7107-5p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-7107-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-7107-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-7107-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission