pre-miRNA Information
pre-miRNA hsa-mir-3911   
Genomic Coordinates chr9: 127690687 - 127690795
Description Homo sapiens miR-3911 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3911
Sequence 12| UGUGUGGAUCCUGGAGGAGGCA |33
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
431152 7 ClinVar
COSM3847691 15 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs943029638 2 dbSNP
rs780635543 3 dbSNP
rs371437556 6 dbSNP
rs1135401819 7 dbSNP
rs748706130 14 dbSNP
rs1403241180 15 dbSNP
rs779344153 17 dbSNP
rs755366929 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MRPL37   
Synonyms L2mt, L37mt, MRP-L2, MRP-L37, MRPL2, RPML2
Description mitochondrial ribosomal protein L37
Transcript NM_016491   
Expression
Putative miRNA Targets on MRPL37
3'UTR of MRPL37
(miRNA target sites are highlighted)
>MRPL37|NM_016491|3'UTR
   1 GCGGAGGACCCCTCTGAATCCTGAAACCCCTCTTGCCTCTCTTCCACGGAAGAGGGCCTGGGCCCCGTGGAGCCTCAGTG
  81 CCCGTTTGGCCTGCTGCTCTCGCTGACAATAAAGAGCCCTTGCGTTGCACTGAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' acGGAGGA--GGUCCUAGGUGUgu 5'
            ||||:|  |:    |||||:  
Target 5' ccCCTCTTGCCTCTCTTCCACGga 3'
27 - 50 114.00 -18.50
2
miRNA  3' acgGAGGAGGUCCUAGGugugu 5'
             | ||||: | ||||     
Target 5' ggaCCCCTCT-GAATCCtgaaa 3'
6 - 26 82.00 -12.83
3
miRNA  3' acGGA---GGAGGUCCUAGGUGUgu 5'
            |||   || |  ||| || ||  
Target 5' ggCCTGGGCCCCGTGGAGCCTCAgt 3'
55 - 79 80.00 -16.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN503912 4 COSMIC
COSN30147470 24 COSMIC
COSN30151898 33 COSMIC
COSN7052374 40 COSMIC
COSN28843761 48 COSMIC
COSN31494949 51 COSMIC
COSN31612815 63 COSMIC
COSN30492961 68 COSMIC
COSN30139204 85 COSMIC
COSN30518824 94 COSMIC
COSN30518830 95 COSMIC
COSN31511460 119 COSMIC
COSN30117623 121 COSMIC
COSN26985063 125 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs764830454 2 dbSNP
rs148209374 3 dbSNP
rs6621 4 dbSNP
rs1484781242 10 dbSNP
rs763894770 11 dbSNP
rs751533561 21 dbSNP
rs1266103117 23 dbSNP
rs943553531 27 dbSNP
rs1284097089 28 dbSNP
rs533397409 33 dbSNP
rs549872566 48 dbSNP
rs746084904 49 dbSNP
rs368651967 58 dbSNP
rs921041345 64 dbSNP
rs931037461 66 dbSNP
rs1062675 67 dbSNP
rs35021811 68 dbSNP
rs555053379 74 dbSNP
rs1397222183 79 dbSNP
rs965855045 80 dbSNP
rs373173369 84 dbSNP
rs566317874 85 dbSNP
rs939936503 90 dbSNP
rs1472038418 91 dbSNP
rs1200673303 97 dbSNP
rs777884274 102 dbSNP
rs575999835 103 dbSNP
rs1444136237 124 dbSNP
rs906456526 125 dbSNP
rs967916782 126 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' acggaggagguccuaGGUGUGu 5'
                         |||||| 
Target 5' gucugggggccgagaCCACACa 3'
3 - 24
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000487429.1 | 3UTR | aagucugggggccgagaccacacagg
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUSC 0.825 0.09 0.800 0.1 4 Click to see details
THCA -0.754 0.12 -0.800 0.1 4 Click to see details
BRCA 0.279 0.32 0.600 0.14 5 Click to see details
HNSC 0.064 0.45 0.536 0.11 7 Click to see details
HNSC 0.064 0.45 0.536 0.11 7 Click to see details
HNSC 0.064 0.45 0.536 0.11 7 Click to see details
HNSC 0.064 0.45 0.536 0.11 7 Click to see details
HNSC 0.064 0.45 0.536 0.11 7 Click to see details
HNSC 0.064 0.45 0.536 0.11 7 Click to see details
HNSC 0.064 0.45 0.536 0.11 7 Click to see details
70 hsa-miR-3911 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT207399 MAT2A methionine adenosyltransferase 2A 2 6
MIRT284537 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT291946 TPM4 tropomyosin 4 2 2
MIRT293609 PVR poliovirus receptor 2 2
MIRT357688 PAIP2 poly(A) binding protein interacting protein 2 2 2
MIRT451607 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT452110 IFITM1 interferon induced transmembrane protein 1 2 2
MIRT457804 KLHL25 kelch like family member 25 2 2
MIRT462730 EFNB1 ephrin B1 2 2
MIRT463219 ZNF131 zinc finger protein 131 2 2
MIRT464141 VPS28 VPS28, ESCRT-I subunit 2 2
MIRT467582 SLC7A5 solute carrier family 7 member 5 2 6
MIRT470824 PLXND1 plexin D1 2 2
MIRT474230 LCLAT1 lysocardiolipin acyltransferase 1 2 2
MIRT478989 COLGALT1 collagen beta(1-O)galactosyltransferase 1 2 2
MIRT479462 CDK6 cyclin dependent kinase 6 2 2
MIRT483558 SYT2 synaptotagmin 2 2 2
MIRT484483 SLC9A1 solute carrier family 9 member A1 2 2
MIRT485224 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT490356 DPYSL5 dihydropyrimidinase like 5 2 4
MIRT493177 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 2
MIRT509802 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT511815 HDGF heparin binding growth factor 2 2
MIRT512254 ARPP19 cAMP regulated phosphoprotein 19 2 6
MIRT513025 GPT2 glutamic--pyruvic transaminase 2 2 2
MIRT519640 ZNF772 zinc finger protein 772 2 4
MIRT531178 SIGLEC12 sialic acid binding Ig like lectin 12 (gene/pseudogene) 2 2
MIRT537870 EDA2R ectodysplasin A2 receptor 2 2
MIRT551914 IGLON5 IgLON family member 5 2 2
MIRT558359 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT559771 URGCP-MRPS24 URGCP-MRPS24 readthrough 2 4
MIRT559813 ZNF83 zinc finger protein 83 2 2
MIRT561999 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT565754 SERTAD2 SERTA domain containing 2 2 2
MIRT569423 DCAF8 DDB1 and CUL4 associated factor 8 2 2
MIRT569845 RGS5 regulator of G protein signaling 5 2 2
MIRT606928 CDK15 cyclin dependent kinase 15 2 2
MIRT607616 TMEM130 transmembrane protein 130 2 4
MIRT607629 TRIOBP TRIO and F-actin binding protein 2 2
MIRT607885 SATB1 SATB homeobox 1 2 2
MIRT607942 SSX2 SSX family member 2 2 4
MIRT608017 CARNS1 carnosine synthase 1 2 4
MIRT608036 UBLCP1 ubiquitin like domain containing CTD phosphatase 1 2 2
MIRT608063 SSX2B SSX family member 2B 2 4
MIRT608558 SBK1 SH3 domain binding kinase 1 2 6
MIRT608915 NCDN neurochondrin 2 6
MIRT615876 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 2 4
MIRT618023 ELFN1 extracellular leucine rich repeat and fibronectin type III domain containing 1 2 2
MIRT620505 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT628101 IL1RAPL1 interleukin 1 receptor accessory protein like 1 2 2
MIRT628700 ZNF548 zinc finger protein 548 2 2
MIRT630658 POU2F1 POU class 2 homeobox 1 2 2
MIRT643508 ZNF28 zinc finger protein 28 2 2
MIRT646379 SLC22A6 solute carrier family 22 member 6 2 2
MIRT660041 C15orf61 chromosome 15 open reading frame 61 2 2
MIRT687700 KRR1 KRR1, small subunit processome component homolog 2 2
MIRT688858 CAMKK2 calcium/calmodulin dependent protein kinase kinase 2 2 2
MIRT690443 REPIN1 replication initiator 1 2 2
MIRT690456 ZNF33A zinc finger protein 33A 2 2
MIRT693796 RHOG ras homolog family member G 2 2
MIRT694274 ZNF529 zinc finger protein 529 2 4
MIRT697697 WAC WW domain containing adaptor with coiled-coil 2 2
MIRT700242 RCC2 regulator of chromosome condensation 2 2 2
MIRT701836 MRPL37 mitochondrial ribosomal protein L37 2 2
MIRT704255 DHCR24 24-dehydrocholesterol reductase 2 2
MIRT707203 SDK2 sidekick cell adhesion molecule 2 2 2
MIRT710365 CREB5 cAMP responsive element binding protein 5 2 2
MIRT711943 WDFY1 WD repeat and FYVE domain containing 1 2 2
MIRT715496 MAZ MYC associated zinc finger protein 2 2
MIRT719250 MS4A1 membrane spanning 4-domains A1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-3911 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3911 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-3911 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-3911 Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3911 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3911 Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-mir-3911 Vincristine 5978 approved resistant cell line (W1)
hsa-mir-3911 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-miR-3911 Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-3911 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3911 Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-3911 Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-3911 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-3911 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3911 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-3911 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission