pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4260 |
Genomic Coordinates | chr1: 209623444 - 209623510 |
Description | Homo sapiens miR-4260 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4260 | ||||||||||||
Sequence | 11| CUUGGGGCAUGGAGUCCCA |29 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | SOLiD | DRVs in miRNA |
|
||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | MINK1 | ||||||||||||||||||||
Synonyms | B55, MAP4K6, MINK, YSK2, ZC3 | ||||||||||||||||||||
Description | misshapen like kinase 1 | ||||||||||||||||||||
Transcript | NM_001024937 | ||||||||||||||||||||
Other Transcripts | NM_015716 , NM_153827 , NM_170663 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on MINK1 | |||||||||||||||||||||
3'UTR of MINK1 (miRNA target sites are highlighted) |
>MINK1|NM_001024937|3'UTR 1 CGGGGCCCTGGGCTGGGGCTGTCCCACACTGGACCCAGCTCTCCCCCTGCAGCCAGGCTTCCCGGGCCGCCCCTCTTTCC 81 CCTCCCTGGGCTTTTGCTTTTACTGGTTTGATTTCACTGGAGCCTGCTGGGAACGTGACCTCTGACCCCTGATGCTTTCG 161 TGATCACGTGACCATCCTCTTCCCCAACATGTCCTCTTCCCAAAACTGTGCCTGTCCCCAGCTTCTGGGGAGGGACACAG 241 CTTCCCCTTCCCAGGAATTGAGTGGGCCTAGCCCCTCCCCCCTTTTCTCCATTTGAGAGGAGAGTGCTTGGGGCTTGAAC 321 CCCTTACCCCACTGCTGCTGACTGGGCAGGGCCCTGGACCCCTTTATTTGCACGTCAGGGGAGCCGGCTCCCCCCTTGAA 401 TGTACCAGACCCTGGGGGGGGTCACTGGGCCCTAGATTTTTGGGGGGTCACCAGCCACTCCAGGGGCAGGGACCATTTCT 481 TCATTTTCTGAAAGCACTTTAATGATTCCCCTTCCCCCAAACTCCAGGGAATGGAGGGGGGACCCCGCCAGCCAAAACAT 561 TCCCCCCATTCCCGACCCCCCTCTCCTCTTCTAGCCCATGCCCTTCCCCGGTGGAGGGAGGGAGCAGGGAGCCCTCACTC 641 TCCACGCCCCTTGCTTGCATCTGTATATAGTGTGAGCAGCAAGTAACCCTTCTCCCTCCCCCCCCACCCCTCCTCAATGT 721 AGTGGCCTTGGATATCCTGTTTGTTAATAAAGACAATTCAACCAGCTCCCACCAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
miRNA:Target | ---- | |||||||||
Validation Method |
|
|||||||||
Conditions | Hela | |||||||||
Location of target site | 3'UTR | |||||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | |||||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
|||||||||
miRNA-target interactions (Provided by authors) |
|
|||||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000347992.7 | 3UTR | UCAUUUUCUGAAAGCACUUUAAUGAUUCCCCUUCCCCCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
66 hsa-miR-4260 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT074404 | TNRC6A | trinucleotide repeat containing 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT289774 | PER1 | period circadian clock 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442576 | HOXD9 | homeobox D9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443878 | CNKSR3 | CNKSR family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449080 | XPO6 | exportin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450294 | DRAXIN | dorsal inhibitory axon guidance protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT461785 | FXR2 | FMR1 autosomal homolog 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463931 | WNT10B | Wnt family member 10B | ![]() |
![]() |
2 | 2 | ||||||
MIRT464860 | UBB | ubiquitin B | ![]() |
![]() |
2 | 8 | ||||||
MIRT467619 | SLC7A5 | solute carrier family 7 member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469649 | RAC1 | Rac family small GTPase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT473421 | MDM4 | MDM4, p53 regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT473646 | MARCKSL1 | MARCKS like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474213 | LCOR | ligand dependent nuclear receptor corepressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT474335 | KMT2D | lysine methyltransferase 2D | ![]() |
![]() |
2 | 2 | ||||||
MIRT474871 | KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477440 | ELOVL5 | ELOVL fatty acid elongase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478432 | DAZAP2 | DAZ associated protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479851 | CCDC6 | coiled-coil domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482507 | ACTB | actin beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT485473 | IGF1R | insulin like growth factor 1 receptor | ![]() |
![]() |
2 | 8 | ||||||
MIRT485670 | CCDC64 | BICD family like cargo adaptor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT485902 | PGPEP1 | pyroglutamyl-peptidase I | ![]() |
![]() |
2 | 4 | ||||||
MIRT488143 | PRRC2B | proline rich coiled-coil 2B | ![]() |
![]() |
2 | 4 | ||||||
MIRT489455 | MSC | musculin | ![]() |
![]() |
2 | 2 | ||||||
MIRT509568 | HIST2H2AB | histone cluster 2 H2A family member b | ![]() |
![]() |
2 | 4 | ||||||
MIRT513093 | DYNAP | dynactin associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT513256 | CALM3 | calmodulin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT514356 | UBBP4 | ubiquitin B pseudogene 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT522019 | PAQR3 | progestin and adipoQ receptor family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT523164 | HIST3H3 | histone cluster 3 H3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT523297 | HIST1H1B | histone cluster 1 H1 family member b | ![]() |
![]() |
2 | 2 | ||||||
MIRT524782 | BAG5 | BCL2 associated athanogene 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530921 | SCIN | scinderin | ![]() |
![]() |
2 | 2 | ||||||
MIRT533302 | USP44 | ubiquitin specific peptidase 44 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552782 | YIPF4 | Yip1 domain family member 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT553981 | SRPR | SRP receptor alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT563126 | ZNF215 | zinc finger protein 215 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569025 | IL21R | interleukin 21 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT573413 | RPL18A | ribosomal protein L18a | ![]() |
![]() |
2 | 2 | ||||||
MIRT574877 | Dnajc6 | DnaJ heat shock protein family (Hsp40) member C6 | ![]() |
![]() |
2 | 3 | ||||||
MIRT607538 | GLI2 | GLI family zinc finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607682 | MAPK10 | mitogen-activated protein kinase 10 | ![]() |
![]() |
2 | 3 | ||||||
MIRT623791 | GK5 | glycerol kinase 5 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT628834 | FAM151B | family with sequence similarity 151 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT635547 | LEPREL1 | prolyl 3-hydroxylase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635698 | NMNAT2 | nicotinamide nucleotide adenylyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635906 | ARPC1B | actin related protein 2/3 complex subunit 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT649985 | MSI1 | musashi RNA binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654900 | POMGNT1 | protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-) | ![]() |
![]() |
2 | 2 | ||||||
MIRT655116 | PHF7 | PHD finger protein 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658958 | DNAJC6 | DnaJ heat shock protein family (Hsp40) member C6 | ![]() |
![]() |
2 | 3 | ||||||
MIRT659665 | CDC42EP4 | CDC42 effector protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668946 | CNBP | CCHC-type zinc finger nucleic acid binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT691164 | APOL6 | apolipoprotein L6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692696 | MEAF6 | MYST/Esa1 associated factor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693245 | HBS1L | HBS1 like translational GTPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT695203 | SCAMP3 | secretory carrier membrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701957 | MINK1 | misshapen like kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706802 | APOL4 | apolipoprotein L4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716899 | CACNB2 | calcium voltage-gated channel auxiliary subunit beta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717632 | HLX | H2.0 like homeobox | ![]() |
![]() |
2 | 2 | ||||||
MIRT719052 | ZNF281 | zinc finger protein 281 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722973 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723643 | RPTN | repetin | ![]() |
![]() |
2 | 2 | ||||||
MIRT734708 | NR3C2 | nuclear receptor subfamily 3 group C member 2 | ![]() |
![]() |
![]() |
![]() |
4 | 0 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|