pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4486 |
Genomic Coordinates | chr11: 19575310 - 19575372 |
Description | Homo sapiens miR-4486 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4486 | ||||||||||||
Sequence | 5| GCUGGGCGAGGCUGGCA |21 | ||||||||||||
Evidence | Experimental | ||||||||||||
Experiments | Illumina | ||||||||||||
SNPs in miRNA |
|
||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | HERPUD2 | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | HERPUD family member 2 | ||||||||||||||||||||
Transcript | NM_022373 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on HERPUD2 | |||||||||||||||||||||
3'UTR of HERPUD2 (miRNA target sites are highlighted) |
>HERPUD2|NM_022373|3'UTR 1 CCTGAAAAACTGTGCCAGCTACAAGGAGGGTCTGACTTCAGGAAAGTGGTTTAAATAACAGTGCAATTTCAAAAAAATTT 81 ATAACTTTCTTTTGATCATCATGTACAGAGGTGTTTTTTTTCTTTAGGCTTCTCATGCATATGAATATTTTAAGCACGAA 161 TGGACTACTAAATATCTGAGTTTTTTTTTTTTTTTTTTAAAGATCCTAACAGAACATAGCGTAACAATATTGGTCTTCCA 241 GGTGTTACTCATTTCAATTATGTGTAGTATACCAGGACAGACCTATTTTCATGTCTTATTTCTTTAAAGAGCTGCTTCAT 321 TGGCCGGGCGCCATGGCTCACGTCTGTAATCCCAGCACTTTGGGAGGCCGAGGCGGGTGGGTTACTTGAGGTCAGGAGTT 401 CGAGACCAGCCTGGCAAACATGGCGAAACCCCATCTTAACTAAAAATACAAAAAAATTAGCCGGGTGTGGTGTCACGCGC 481 CTGTAATCCCAGCTACTTGGGGGGCTCAGGCAGGAGAATTGCCTGAACCCAGGAGGCGGAGGTTGCAGTGAGCTGAGATT 561 GGGCCACTGCACTCCACCCTGGGCGACAGAGTGAGACTCGGTCTCAGAAAAAAAAAAAAAAGAGCTGCTTCACATATAAA 641 TGTCTATAGCTAGTAGCCTGGCCCTTTAATGTTTAATTTGAATAGATATATCTGTTTTCCGTGAATTATCTTGAAAGTTT 721 TAAACAGAATGACCTCATAGTTTTTAATAAAGAATATTATTTACCTAAAATGTGCTAGTAGCATCTTGCCCAGCCATAAA 801 GCAATAAACTTCTCAATAATCTTAATTTTGATATTTGAATAAATAATGGAAACTTTCTGTATTAAGGGCATGTATCCCAT 881 CAATTGGAATCAGTACCTTAACAGAAAAAGGCAGCTCTTCAATGGAATTAACGTGATATAAAATGTTTGATATAGGCAGT 961 ACTTTTATAAAAAAAGATAAGCTGGAAATTGCTCCGTGTAATTTTTTAAATAAAAAGTCAATTATGGTAAAAAAAAAAAA 1041 AAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Hela | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000396081.1 | 3UTR | ACUCUAUCGCCCAGGCUGGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
108 hsa-miR-4486 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT254654 | NF2 | neurofibromin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458684 | MRI1 | methylthioribose-1-phosphate isomerase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470845 | PLXND1 | plexin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493011 | NANOS1 | nanos C2HC-type zinc finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497264 | GRK6 | G protein-coupled receptor kinase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497675 | SYNGR1 | synaptogyrin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498219 | TLN2 | talin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498310 | BCL11B | B-cell CLL/lymphoma 11B | ![]() |
![]() |
2 | 2 | ||||||
MIRT504048 | TOMM5 | translocase of outer mitochondrial membrane 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519959 | ZCCHC8 | zinc finger CCHC-type containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531521 | NOM1 | nucleolar protein with MIF4G domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533144 | WNT10A | Wnt family member 10A | ![]() |
![]() |
2 | 2 | ||||||
MIRT533541 | TPR | translocated promoter region, nuclear basket protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT533681 | TMEM86A | transmembrane protein 86A | ![]() |
![]() |
2 | 2 | ||||||
MIRT540321 | PIGR | polymeric immunoglobulin receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT540719 | GUF1 | GUF1 homolog, GTPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT541566 | ZNF43 | zinc finger protein 43 | ![]() |
![]() |
2 | 4 | ||||||
MIRT541787 | TBCCD1 | TBCC domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541925 | ORC1 | origin recognition complex subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT542232 | FUT9 | fucosyltransferase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542285 | POLR3K | RNA polymerase III subunit K | ![]() |
![]() |
2 | 2 | ||||||
MIRT542299 | QTRTD1 | queuine tRNA-ribosyltransferase accessory subunit 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT542368 | PAICS | phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT542441 | C3 | complement C3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT542475 | APOC3 | apolipoprotein C3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542535 | MRPS10 | mitochondrial ribosomal protein S10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542640 | TIMM8A | translocase of inner mitochondrial membrane 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT542788 | PLEKHA3 | pleckstrin homology domain containing A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552104 | PPP1R1A | protein phosphatase 1 regulatory inhibitor subunit 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT564913 | YTHDF1 | YTH N6-methyladenosine RNA binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568606 | ACVR2A | activin A receptor type 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT607389 | LANCL3 | LanC like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607451 | ZNF543 | zinc finger protein 543 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610058 | MYBPC1 | myosin binding protein C, slow type | ![]() |
![]() |
2 | 2 | ||||||
MIRT610793 | KLK2 | kallikrein related peptidase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617176 | GOSR2 | golgi SNAP receptor complex member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620579 | WBSCR27 | methyltransferase like 27 | ![]() |
![]() |
2 | 4 | ||||||
MIRT622085 | SRPX2 | sushi repeat containing protein, X-linked 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622542 | PXMP4 | peroxisomal membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630009 | PDE6B | phosphodiesterase 6B | ![]() |
![]() |
2 | 2 | ||||||
MIRT631813 | PTDSS2 | phosphatidylserine synthase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632721 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | ![]() |
![]() |
2 | 2 | ||||||
MIRT632757 | MED28 | mediator complex subunit 28 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634821 | ASB6 | ankyrin repeat and SOCS box containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635255 | FBXL20 | F-box and leucine rich repeat protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637082 | SELPLG | selectin P ligand | ![]() |
![]() |
2 | 2 | ||||||
MIRT637357 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637472 | DEFB105B | defensin beta 105B | ![]() |
![]() |
2 | 4 | ||||||
MIRT637504 | DEFB105A | defensin beta 105A | ![]() |
![]() |
2 | 4 | ||||||
MIRT639022 | AAK1 | AP2 associated kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641012 | ANKFY1 | ankyrin repeat and FYVE domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642170 | HEBP2 | heme binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648977 | ACAD8 | acyl-CoA dehydrogenase family member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650515 | UFM1 | ubiquitin fold modifier 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650949 | INMT | indolethylamine N-methyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT658354 | FAM65B | RHO family interacting cell polarization regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660736 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT662191 | MEI1 | meiotic double-stranded break formation protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663045 | SLC16A4 | solute carrier family 16 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664811 | IRAK3 | interleukin 1 receptor associated kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665161 | SF3A1 | splicing factor 3a subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT665346 | YES1 | YES proto-oncogene 1, Src family tyrosine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT666493 | SBNO1 | strawberry notch homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666545 | RNF115 | ring finger protein 115 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669351 | BMP3 | bone morphogenetic protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669904 | KIAA0754 | KIAA0754 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670323 | CEP57L1 | centrosomal protein 57 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670430 | ELP2 | elongator acetyltransferase complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670672 | KIAA1551 | KIAA1551 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670746 | HOOK3 | hook microtubule tethering protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670998 | PTGIS | prostaglandin I2 synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT671290 | RPL37A | ribosomal protein L37a | ![]() |
![]() |
2 | 2 | ||||||
MIRT671469 | AGPAT6 | glycerol-3-phosphate acyltransferase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671833 | STIL | STIL, centriolar assembly protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT673006 | TAF1 | TATA-box binding protein associated factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675881 | CSTF1 | cleavage stimulation factor subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678625 | OLFML2A | olfactomedin like 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT678790 | NUPL2 | nucleoporin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679560 | LIN9 | lin-9 DREAM MuvB core complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT681032 | AAED1 | AhpC/TSA antioxidant enzyme domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682480 | LIX1L | limb and CNS expressed 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT682758 | MDM2 | MDM2 proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT682810 | TMCO1 | transmembrane and coiled-coil domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682867 | C9orf156 | tRNA methyltransferase O | ![]() |
![]() |
2 | 2 | ||||||
MIRT689233 | RPS19 | ribosomal protein S19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689305 | C5AR2 | complement component 5a receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689363 | ZNF101 | zinc finger protein 101 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689629 | NAA30 | N(alpha)-acetyltransferase 30, NatC catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT689654 | RBM23 | RNA binding motif protein 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690148 | PPIL6 | peptidylprolyl isomerase like 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691407 | DNA2 | DNA replication helicase/nuclease 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691847 | OSCAR | osteoclast associated, immunoglobulin-like receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT692234 | ALDH1B1 | aldehyde dehydrogenase 1 family member B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694320 | NLRP9 | NLR family pyrin domain containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694365 | CHST6 | carbohydrate sulfotransferase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696215 | LYZ | lysozyme | ![]() |
![]() |
2 | 2 | ||||||
MIRT697230 | ZYG11A | zyg-11 family member A, cell cycle regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT700487 | PTPRF | protein tyrosine phosphatase, receptor type F | ![]() |
![]() |
2 | 2 | ||||||
MIRT700612 | PRKCA | protein kinase C alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT702456 | KIAA1467 | family with sequence similarity 234 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT702990 | HERPUD2 | HERPUD family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703998 | EIF5A2 | eukaryotic translation initiation factor 5A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT704701 | CHRFAM7A | CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion | ![]() |
![]() |
2 | 2 | ||||||
MIRT712481 | FSTL3 | follistatin like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712781 | ZNF154 | zinc finger protein 154 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714369 | HP1BP3 | heterochromatin protein 1 binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722570 | C1orf95 | stum, mechanosensory transduction mediator homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT722839 | C17orf102 | chromosome 17 open reading frame 102 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|