pre-miRNA Information
pre-miRNA hsa-mir-210   
Genomic Coordinates chr11: 568089 - 568198
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 11 - 568122 25582055 MiREDiBase
A-to-I 14 11 - 568120 26028588 MiREDiBase
C-to-U 1 11 - 568133 26209130 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs753825152 1 dbSNP
rs759616365 3 dbSNP
rs1247955373 6 dbSNP
rs558661304 9 dbSNP
rs1490451308 13 dbSNP
rs1344162213 14 dbSNP
rs745930382 15 dbSNP
rs1220183952 16 dbSNP
rs1355496181 17 dbSNP
rs1280245998 19 dbSNP
rs781628850 20 dbSNP
rs1241231800 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Low Blood Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol GTDC1   
Synonyms Hmat-Xa, mat-Xa
Description glycosyltransferase like domain containing 1
Transcript NM_001006636   
Other Transcripts NM_001164629 , NM_024659   
Expression
Putative miRNA Targets on GTDC1
3'UTR of GTDC1
(miRNA target sites are highlighted)
>GTDC1|NM_001006636|3'UTR
   1 CAGATGGGGCTAAGTCACAAACTTGCAGCCTAAGGCAGAATCTGAAGAACTTTCCAGAGTGTGCCCATATTTACCTGATC
  81 AGAGAGAAAAGAAAATCTGCAGAGGAAGCTGAGCCTGGCTGCTTGTCATAGCTGACACAGAGCCATCTGCCACAAACCTG
 161 TGGCGGCTTCAGATCTCCAATCCCTGCCACCACCCCAACTCAAATTAAATACAGATTCCTAGAGACGTTATGATGGTTAC
 241 ACATGTCCTCGGCATCACATGTAGGAGACTGTTCAAAAAAAATATGTGGCCTGTTGTATAACCGCACTCATGTATCCCAT
 321 ATGTGGTGCCACATTGAATTTCCGGTTGAATCCGTTTTTATCCTTTGTACTGGATGACATGGTGCCTGAATTCTTTCTTT
 401 TCGCCGACACGATGGCAGCCAAACTGCAGCTTCAAACGCTCACACTTGGCTGGGTTTCTACCTAGGTTGCCAGGTTATCA
 481 TCGGAGCCTTCTTGTGTCCTCAAAGGGCCACGAGGCCTGAAAGGAGGATCAGAATGCTTTGGGATTAATTGGGCAGCCAT
 561 CGCAGAATTGTTTGTGGGCAAAGGGCTGCTTTAGCACTTTTCTTTTAGCAAATTAATGACTCTCAGGCACAGGGGGTTTT
 641 AAGTGAAGGTATTAATAAGAGGTCTGGCAGGTATTCCCATGATTCACAGAGTTACATTTGCATTTAATTAATCTTAAAGT
 721 TGCAAGATAAACAGCTGTAATTCGGACAAACATGACAAACACAGTGAAGCCAACTATCCCATAAAATGAACACTGACATA
 801 CTTGTTTTAATTTTTTTCCCAGCGTAAAAATAGAAAAATCAAAATACTCCTAACAAAACCAGTGATTTTGATAGAAATAT
 881 TTCTCCAATATACTTGCATCCACCTACAAATATAACCTTTTCAAGATAAATCGCTTATGATTTCAATAGTCAAACTGCTG
 961 TGTTTGTTGATGTAAAGATGTTTTGAATGGCTAGATGGTAAAATAAATTCTTAATAAAGTACCCACTGCAATTTTTAAAA
1041 AAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' aguCGGCGACAGUGUGCGUGUc 5'
             || ||| ||| |||| || 
Target 5' actGCAGCT-TCAAACGCTCAc 3'
423 - 443 134.00 -13.20
2
miRNA  3' agucggcgacAGUGUGCGUGUc 5'
                    || || ||||| 
Target 5' aattaatgacTCTCAGGCACAg 3'
611 - 632 120.00 -13.80
3
miRNA  3' agUCGG-CGACA-GUGUGCGUGuc 5'
            :||| |:||| :|  |||||  
Target 5' gtGGCCTGTTGTATAACCGCACtc 3'
286 - 309 112.00 -18.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30522068 3 COSMIC
COSN31599073 14 COSMIC
COSN30499090 22 COSMIC
COSN30508329 51 COSMIC
COSN508526 86 COSMIC
COSN30164176 140 COSMIC
COSN20074539 164 COSMIC
COSN9861769 165 COSMIC
COSN23998529 222 COSMIC
COSN1794677 226 COSMIC
COSN31603356 343 COSMIC
COSN31597320 402 COSMIC
COSN23522340 403 COSMIC
COSN7344859 447 COSMIC
COSN31576957 465 COSMIC
COSN6194531 478 COSMIC
COSN8607609 482 COSMIC
COSN24299075 510 COSMIC
COSN31480976 519 COSMIC
COSN31595460 563 COSMIC
COSN16506088 689 COSMIC
COSN23730625 1154 COSMIC
COSN30341303 1466 COSMIC
COSN9065887 1780 COSMIC
COSN20097213 2119 COSMIC
COSN23189943 2329 COSMIC
COSN21973508 2370 COSMIC
COSN22157454 2464 COSMIC
COSN17121747 2502 COSMIC
COSN22643093 2546 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs780069606 8 dbSNP
rs1301477508 9 dbSNP
rs1420352315 11 dbSNP
rs767332988 12 dbSNP
rs1397047227 17 dbSNP
rs1327406409 18 dbSNP
rs759368176 22 dbSNP
rs371348248 26 dbSNP
rs1328362802 32 dbSNP
rs576790834 36 dbSNP
rs1390239481 41 dbSNP
rs761947879 50 dbSNP
rs951739589 53 dbSNP
rs1340831078 61 dbSNP
rs1027166575 79 dbSNP
rs1260498093 96 dbSNP
rs758644671 104 dbSNP
rs995711654 110 dbSNP
rs1212331212 121 dbSNP
rs558904138 125 dbSNP
rs897327867 127 dbSNP
rs1215244564 143 dbSNP
rs1257338471 144 dbSNP
rs1335453273 156 dbSNP
rs1037714155 157 dbSNP
rs997954141 164 dbSNP
rs550709063 165 dbSNP
rs779079603 193 dbSNP
rs1242959055 196 dbSNP
rs1476432047 197 dbSNP
rs1008467746 198 dbSNP
rs1217299892 199 dbSNP
rs914887201 211 dbSNP
rs532277358 226 dbSNP
rs757710377 227 dbSNP
rs1386611720 232 dbSNP
rs571034597 236 dbSNP
rs1318531762 243 dbSNP
rs1270707695 251 dbSNP
rs1401689860 260 dbSNP
rs1277029960 267 dbSNP
rs891133745 271 dbSNP
rs1335318429 273 dbSNP
rs1049710648 274 dbSNP
rs1235090181 283 dbSNP
rs1338328354 283 dbSNP
rs927501139 285 dbSNP
rs932745514 288 dbSNP
rs1355342852 296 dbSNP
rs754136015 303 dbSNP
rs552540243 304 dbSNP
rs971543387 307 dbSNP
rs1262607565 311 dbSNP
rs1054465568 318 dbSNP
rs1190670691 319 dbSNP
rs917456922 325 dbSNP
rs1415451142 332 dbSNP
rs200075913 343 dbSNP
rs756507083 344 dbSNP
rs187090673 353 dbSNP
rs1386606132 354 dbSNP
rs1398596531 366 dbSNP
rs981776350 369 dbSNP
rs961445851 377 dbSNP
rs1355562588 379 dbSNP
rs949972541 382 dbSNP
rs1173269001 390 dbSNP
rs1477162253 401 dbSNP
rs1423510657 402 dbSNP
rs1192352837 403 dbSNP
rs142859776 405 dbSNP
rs767086243 406 dbSNP
rs991121941 408 dbSNP
rs530054999 410 dbSNP
rs951686572 411 dbSNP
rs1258541379 415 dbSNP
rs1220221397 423 dbSNP
rs1285640019 426 dbSNP
rs954066392 437 dbSNP
rs1277448980 438 dbSNP
rs1027447208 439 dbSNP
rs1423757289 455 dbSNP
rs558616838 460 dbSNP
rs1365941978 467 dbSNP
rs1468237391 473 dbSNP
rs971790418 479 dbSNP
rs538906352 482 dbSNP
rs562578536 483 dbSNP
rs1447661458 494 dbSNP
rs901004074 494 dbSNP
rs1042262345 498 dbSNP
rs1015734286 512 dbSNP
rs1333747854 517 dbSNP
rs1333851819 531 dbSNP
rs1008914985 541 dbSNP
rs1053958701 542 dbSNP
rs1348938470 543 dbSNP
rs544278699 544 dbSNP
rs891342854 549 dbSNP
rs926305486 561 dbSNP
rs774184710 562 dbSNP
rs1196906568 569 dbSNP
rs1253341258 570 dbSNP
rs576972183 574 dbSNP
rs1044661461 583 dbSNP
rs182585056 600 dbSNP
rs1028985459 603 dbSNP
rs996842048 606 dbSNP
rs950320384 626 dbSNP
rs1173298238 632 dbSNP
rs1166226660 633 dbSNP
rs917509324 634 dbSNP
rs1423906502 643 dbSNP
rs1394327936 654 dbSNP
rs893120183 655 dbSNP
rs1360740122 656 dbSNP
rs1371909104 661 dbSNP
rs1443420257 666 dbSNP
rs1299220636 667 dbSNP
rs116007755 668 dbSNP
rs1228292619 672 dbSNP
rs940198529 676 dbSNP
rs573044687 679 dbSNP
rs1179600511 681 dbSNP
rs761535240 689 dbSNP
rs1472293024 693 dbSNP
rs1189081795 695 dbSNP
rs1266284465 706 dbSNP
rs934715880 707 dbSNP
rs903031462 712 dbSNP
rs1171972171 713 dbSNP
rs1176515936 713 dbSNP
rs909946241 713 dbSNP
rs1464850089 716 dbSNP
rs1421316488 718 dbSNP
rs762822640 721 dbSNP
rs1165323527 722 dbSNP
rs950018974 728 dbSNP
rs189026966 744 dbSNP
rs1367243052 747 dbSNP
rs769802549 752 dbSNP
rs1297822502 755 dbSNP
rs1339038885 762 dbSNP
rs1218593767 763 dbSNP
rs1274408689 766 dbSNP
rs185916563 769 dbSNP
rs1219914872 772 dbSNP
rs1222140749 774 dbSNP
rs1264477692 776 dbSNP
rs1485996782 788 dbSNP
rs1187690520 793 dbSNP
rs930320607 796 dbSNP
rs1323429005 808 dbSNP
rs1310742272 811 dbSNP
rs776531896 813 dbSNP
rs971821594 814 dbSNP
rs961797868 816 dbSNP
rs866159076 823 dbSNP
rs1016184913 824 dbSNP
rs987021213 839 dbSNP
rs1163826924 845 dbSNP
rs893648899 861 dbSNP
rs1454532272 863 dbSNP
rs1300062540 880 dbSNP
rs1358683532 887 dbSNP
rs181676446 889 dbSNP
rs1399524592 897 dbSNP
rs1032072865 903 dbSNP
rs1001988654 905 dbSNP
rs1312461105 916 dbSNP
rs776917212 916 dbSNP
rs955725008 919 dbSNP
rs949042008 922 dbSNP
rs1283499024 925 dbSNP
rs1028555576 933 dbSNP
rs1211060469 941 dbSNP
rs997039931 944 dbSNP
rs1259511998 953 dbSNP
rs557021934 960 dbSNP
rs1037710595 971 dbSNP
rs1181027927 978 dbSNP
rs1348629527 983 dbSNP
rs538732062 998 dbSNP
rs571404699 1005 dbSNP
rs1420710676 1006 dbSNP
rs1162143593 1010 dbSNP
rs1378774774 1010 dbSNP
rs940186942 1013 dbSNP
rs1313570911 1015 dbSNP
rs1361335516 1018 dbSNP
rs1446496807 1022 dbSNP
rs910067850 1049 dbSNP
rs984212186 1064 dbSNP
rs1242817374 1069 dbSNP
rs893149869 1070 dbSNP
rs1404207921 1071 dbSNP
rs1380558992 1073 dbSNP
rs1032948767 1074 dbSNP
rs1180071476 1078 dbSNP
rs759874721 1079 dbSNP
rs1352600210 1090 dbSNP
rs1234298931 1092 dbSNP
rs552693598 1095 dbSNP
rs999345468 1096 dbSNP
rs1209309591 1102 dbSNP
rs1233432181 1108 dbSNP
rs772182677 1109 dbSNP
rs1046227341 1111 dbSNP
rs527903328 1118 dbSNP
rs787174 1119 dbSNP
rs965361638 1127 dbSNP
rs201238279 1128 dbSNP
rs1354445975 1136 dbSNP
rs141682011 1140 dbSNP
rs776939245 1150 dbSNP
rs1020845732 1151 dbSNP
rs920277032 1152 dbSNP
rs1035991200 1171 dbSNP
rs76821106 1176 dbSNP
rs1353258593 1179 dbSNP
rs1329742901 1183 dbSNP
rs957889044 1196 dbSNP
rs1441208673 1211 dbSNP
rs1276300839 1213 dbSNP
rs1342227829 1216 dbSNP
rs1218203945 1217 dbSNP
rs1273616070 1218 dbSNP
rs911684374 1241 dbSNP
rs987606851 1246 dbSNP
rs1302477247 1248 dbSNP
rs1196451401 1252 dbSNP
rs1388861741 1254 dbSNP
rs1237373492 1258 dbSNP
rs1032630384 1259 dbSNP
rs1194477719 1272 dbSNP
rs1366161416 1281 dbSNP
rs1248713198 1291 dbSNP
rs1190741044 1298 dbSNP
rs757361629 1299 dbSNP
rs1002041083 1303 dbSNP
rs921401479 1305 dbSNP
rs369303419 1308 dbSNP
rs975654241 1310 dbSNP
rs904910547 1313 dbSNP
rs1160090934 1322 dbSNP
rs957577267 1329 dbSNP
rs1417543305 1331 dbSNP
rs1325113957 1332 dbSNP
rs1013235920 1334 dbSNP
rs1435058446 1335 dbSNP
rs562540385 1337 dbSNP
rs749664519 1344 dbSNP
rs1270279220 1351 dbSNP
rs1342247982 1358 dbSNP
rs897510065 1366 dbSNP
rs1037275250 1368 dbSNP
rs1176577036 1375 dbSNP
rs1335198410 1376 dbSNP
rs940298332 1382 dbSNP
rs1265212938 1391 dbSNP
rs1190497527 1394 dbSNP
rs1032979636 1402 dbSNP
rs544241476 1405 dbSNP
rs1265520990 1406 dbSNP
rs1198167887 1408 dbSNP
rs1242800027 1413 dbSNP
rs919915963 1416 dbSNP
rs967782489 1419 dbSNP
rs1423633661 1420 dbSNP
rs532431049 1423 dbSNP
rs1256774625 1429 dbSNP
rs1165379492 1434 dbSNP
rs565236949 1441 dbSNP
rs147814870 1443 dbSNP
rs894327927 1447 dbSNP
rs572968700 1448 dbSNP
rs1342933746 1449 dbSNP
rs1299553503 1452 dbSNP
rs1277480437 1457 dbSNP
rs1238483056 1467 dbSNP
rs1397554831 1473 dbSNP
rs1246638973 1474 dbSNP
rs1055613296 1478 dbSNP
rs1354451998 1485 dbSNP
rs913920105 1491 dbSNP
rs3731956 1493 dbSNP
rs1467405960 1494 dbSNP
rs542918972 1524 dbSNP
rs1263032142 1525 dbSNP
rs375392801 1527 dbSNP
rs899048689 1528 dbSNP
rs958155511 1529 dbSNP
rs1190006661 1536 dbSNP
rs1478142886 1537 dbSNP
rs925232881 1541 dbSNP
rs1158752286 1544 dbSNP
rs1425653539 1546 dbSNP
rs1417304632 1549 dbSNP
rs1036278364 1554 dbSNP
rs969230030 1561 dbSNP
rs1487979531 1575 dbSNP
rs140560332 1576 dbSNP
rs556985114 1585 dbSNP
rs771449122 1595 dbSNP
rs961727003 1608 dbSNP
rs1051533744 1609 dbSNP
rs1310250386 1610 dbSNP
rs1356145416 1610 dbSNP
rs1015041181 1614 dbSNP
rs538643145 1618 dbSNP
rs1005885977 1631 dbSNP
rs1202676802 1635 dbSNP
rs547981265 1645 dbSNP
rs761028876 1654 dbSNP
rs1276815043 1656 dbSNP
rs1216281317 1662 dbSNP
rs1179718927 1668 dbSNP
rs1048638739 1669 dbSNP
rs1325296468 1674 dbSNP
rs996946340 1682 dbSNP
rs552811210 1684 dbSNP
rs1467172106 1690 dbSNP
rs1041095690 1695 dbSNP
rs1312997803 1698 dbSNP
rs1401483398 1710 dbSNP
rs944159042 1711 dbSNP
rs1397487720 1712 dbSNP
rs921433896 1719 dbSNP
rs975517267 1720 dbSNP
rs372340656 1724 dbSNP
rs1444875387 1729 dbSNP
rs957529807 1739 dbSNP
rs534751983 1740 dbSNP
rs1254751459 1742 dbSNP
rs1344938548 1757 dbSNP
rs1335891679 1759 dbSNP
rs980705917 1760 dbSNP
rs926248629 1762 dbSNP
rs1456137083 1765 dbSNP
rs1177592556 1770 dbSNP
rs1267695650 1771 dbSNP
rs1434384636 1783 dbSNP
rs969195091 1784 dbSNP
rs368706787 1792 dbSNP
rs764200862 1792 dbSNP
rs753306305 1799 dbSNP
rs1172495655 1807 dbSNP
rs1397817159 1808 dbSNP
rs1464939975 1816 dbSNP
rs1330926476 1817 dbSNP
rs967435180 1821 dbSNP
rs565655360 1822 dbSNP
rs1475132380 1832 dbSNP
rs1014686069 1839 dbSNP
rs1014360205 1842 dbSNP
rs549905750 1845 dbSNP
rs1316443471 1848 dbSNP
rs1189700729 1871 dbSNP
rs1006272738 1880 dbSNP
rs754600525 1884 dbSNP
rs1265607000 1888 dbSNP
rs548811698 1890 dbSNP
rs1207513501 1903 dbSNP
rs751057941 1908 dbSNP
rs1477892129 1909 dbSNP
rs1195708863 1910 dbSNP
rs951764802 1914 dbSNP
rs1477363997 1922 dbSNP
rs766060066 1923 dbSNP
rs1027176153 1924 dbSNP
rs1350616115 1933 dbSNP
rs1459667116 1949 dbSNP
rs1014870647 1952 dbSNP
rs1390078379 1953 dbSNP
rs544607145 1960 dbSNP
rs1459334060 1961 dbSNP
rs1280634723 1966 dbSNP
rs1005178122 1975 dbSNP
rs1218335843 1977 dbSNP
rs890144543 1979 dbSNP
rs762475749 1980 dbSNP
rs1008402427 1987 dbSNP
rs1488326769 1989 dbSNP
rs1218231911 1990 dbSNP
rs1357663407 2000 dbSNP
rs1487923461 2009 dbSNP
rs144150306 2010 dbSNP
rs368288826 2014 dbSNP
rs1421886363 2015 dbSNP
rs1338380930 2026 dbSNP
rs900292863 2027 dbSNP
rs569219566 2053 dbSNP
rs77195936 2054 dbSNP
rs116547682 2055 dbSNP
rs565346192 2062 dbSNP
rs926111954 2063 dbSNP
rs1430674798 2065 dbSNP
rs1303986478 2066 dbSNP
rs1044993826 2067 dbSNP
rs1394717894 2070 dbSNP
rs947993780 2075 dbSNP
rs1409375056 2076 dbSNP
rs977717041 2082 dbSNP
rs374352729 2084 dbSNP
rs946268853 2085 dbSNP
rs546763092 2086 dbSNP
rs1210700636 2089 dbSNP
rs1239177385 2095 dbSNP
rs1482146214 2097 dbSNP
rs1181081826 2106 dbSNP
rs188551902 2107 dbSNP
rs1242693099 2110 dbSNP
rs1165112599 2111 dbSNP
rs1456420935 2112 dbSNP
rs1384869353 2113 dbSNP
rs1179427531 2115 dbSNP
rs62167034 2117 dbSNP
rs1441933789 2118 dbSNP
rs917845154 2123 dbSNP
rs1177414326 2134 dbSNP
rs1336487805 2134 dbSNP
rs1378531012 2134 dbSNP
rs1400237735 2134 dbSNP
rs61418485 2134 dbSNP
rs796916353 2134 dbSNP
rs528612503 2139 dbSNP
rs992369366 2148 dbSNP
rs940549684 2153 dbSNP
rs1375477109 2156 dbSNP
rs547411303 2157 dbSNP
rs1219365702 2158 dbSNP
rs1280575812 2171 dbSNP
rs1178391966 2173 dbSNP
rs1452738964 2174 dbSNP
rs1258495342 2181 dbSNP
rs958687908 2182 dbSNP
rs1034457426 2187 dbSNP
rs371527529 2192 dbSNP
rs907594772 2193 dbSNP
rs149967294 2197 dbSNP
rs963219347 2198 dbSNP
rs1015145861 2203 dbSNP
rs1191856254 2211 dbSNP
rs1427784264 2213 dbSNP
rs1004802357 2219 dbSNP
rs1413296531 2223 dbSNP
rs1240339845 2229 dbSNP
rs1176099322 2234 dbSNP
rs1355404428 2235 dbSNP
rs951702296 2236 dbSNP
rs1353573673 2251 dbSNP
rs890334473 2265 dbSNP
rs575567398 2269 dbSNP
rs1436491743 2276 dbSNP
rs773346029 2281 dbSNP
rs1276138157 2284 dbSNP
rs1030238723 2288 dbSNP
rs563599569 2290 dbSNP
rs995840141 2291 dbSNP
rs974383209 2296 dbSNP
rs772525411 2299 dbSNP
rs1331640894 2304 dbSNP
rs528468284 2305 dbSNP
rs1019836632 2311 dbSNP
rs544988576 2312 dbSNP
rs1053499006 2313 dbSNP
rs1477109179 2315 dbSNP
rs764993189 2318 dbSNP
rs185031389 2319 dbSNP
rs1478974339 2321 dbSNP
rs1042239247 2322 dbSNP
rs946328435 2324 dbSNP
rs917524522 2325 dbSNP
rs564374801 2328 dbSNP
rs1347582784 2329 dbSNP
rs552963435 2332 dbSNP
rs903850518 2343 dbSNP
rs1045050948 2345 dbSNP
rs1379907025 2348 dbSNP
rs139030565 2353 dbSNP
rs573721192 2356 dbSNP
rs192234571 2357 dbSNP
rs1216688324 2360 dbSNP
rs536452315 2361 dbSNP
rs189644742 2362 dbSNP
rs1264443582 2370 dbSNP
rs1223022707 2372 dbSNP
rs1191896582 2379 dbSNP
rs1372846519 2384 dbSNP
rs530918729 2386 dbSNP
rs1276549058 2387 dbSNP
rs1158725881 2389 dbSNP
rs1362333225 2390 dbSNP
rs1398093269 2393 dbSNP
rs940501454 2396 dbSNP
rs907730349 2405 dbSNP
rs550877647 2406 dbSNP
rs1030689705 2407 dbSNP
rs1357559340 2408 dbSNP
rs996038024 2409 dbSNP
rs1245289757 2410 dbSNP
rs538980897 2410 dbSNP
rs112925688 2418 dbSNP
rs1358904094 2422 dbSNP
rs192340597 2433 dbSNP
rs1415419364 2435 dbSNP
rs542464897 2438 dbSNP
rs1171183246 2441 dbSNP
rs902227337 2442 dbSNP
rs1424942556 2443 dbSNP
rs1190069906 2444 dbSNP
rs1193804155 2448 dbSNP
rs1478488834 2449 dbSNP
rs1443659516 2451 dbSNP
rs187764976 2453 dbSNP
rs1417363401 2456 dbSNP
rs1214547219 2458 dbSNP
rs1442636297 2460 dbSNP
rs561440802 2461 dbSNP
rs549172789 2465 dbSNP
rs1380795834 2482 dbSNP
rs1226600610 2483 dbSNP
rs1322780667 2483 dbSNP
rs1057401825 2484 dbSNP
rs1220572344 2485 dbSNP
rs1237051444 2486 dbSNP
rs930433916 2505 dbSNP
rs1338452415 2508 dbSNP
rs937553111 2509 dbSNP
rs1449119838 2515 dbSNP
rs927279541 2517 dbSNP
rs1361101583 2519 dbSNP
rs1239690879 2522 dbSNP
rs1332665056 2523 dbSNP
rs1037668742 2524 dbSNP
rs530742485 2531 dbSNP
rs1478980441 2536 dbSNP
rs1405040850 2540 dbSNP
rs1466006102 2541 dbSNP
rs1401690386 2544 dbSNP
rs1402743961 2546 dbSNP
rs942032249 2547 dbSNP
rs1306433703 2548 dbSNP
rs1332135873 2549 dbSNP
rs1236045098 2552 dbSNP
rs1281976458 2553 dbSNP
rs370170325 2557 dbSNP
rs1466735668 2563 dbSNP
rs907990091 2564 dbSNP
rs1259525808 2568 dbSNP
rs575119166 2570 dbSNP
rs545304390 2571 dbSNP
rs1194689126 2574 dbSNP
rs141622290 2578 dbSNP
rs182783239 2579 dbSNP
rs1460670913 2585 dbSNP
rs1428581168 2587 dbSNP
rs921693094 2594 dbSNP
rs762316770 2615 dbSNP
rs771659810 2615 dbSNP
rs974350581 2615 dbSNP
rs965701063 2617 dbSNP
rs192159207 2628 dbSNP
rs1031975853 2629 dbSNP
rs957082273 2635 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' agucggcgACA-GUGUGCGUGUc 5'
                  ||| :::::||||| 
Target 5' ugugugugUGUGUGUGUGCACAc 3'
14 - 36
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000392869.2 | 3UTR | AUGUAGGAGUGUGUGUGUGUGUGUGUGUGUGCACACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC -0.47 0 -0.460 0 68 Click to see details
PRAD -0.419 0 -0.413 0 50 Click to see details
HNSC -0.423 0 -0.391 0.01 42 Click to see details
UCEC -0.559 0.01 -0.514 0.01 19 Click to see details
KICH -0.393 0.03 -0.369 0.03 25 Click to see details
COAD -0.611 0.05 -0.857 0 8 Click to see details
PAAD 0.826 0.09 0.600 0.2 4 Click to see details
LIHC -0.194 0.09 -0.213 0.07 49 Click to see details
KIRP -0.204 0.13 -0.159 0.19 32 Click to see details
CHOL 0.41 0.14 0.433 0.12 9 Click to see details
ESCA -0.354 0.14 -0.127 0.35 11 Click to see details
LUAD -0.335 0.14 -0.154 0.32 12 Click to see details
STAD -0.124 0.25 -0.108 0.28 32 Click to see details
CESC -0.705 0.25 -0.500 0.33 3 Click to see details
BLCA -0.163 0.26 -0.205 0.21 18 Click to see details
THCA -0.083 0.27 -0.090 0.25 59 Click to see details
PCPG 0.567 0.31 0.500 0.33 3 Click to see details
LUSC 0.056 0.37 0.024 0.44 38 Click to see details
BRCA 0.036 0.37 0.044 0.35 84 Click to see details
BRCA 0.036 0.37 0.044 0.35 84 Click to see details
BRCA 0.036 0.37 0.044 0.35 84 Click to see details
126 hsa-miR-210-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 4 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor like 1 6 3
MIRT000156 RAD52 RAD52 homolog, DNA repair protein 5 3
MIRT001930 NPTX1 neuronal pentraxin 1 3 2
MIRT002024 EFNA3 ephrin A3 8 8
MIRT003153 BDNF brain derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase subunit beta 6 2
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1 like nucleoporin 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 myogenesis regulating glycosidase (putative) 3 1
MIRT003163 ISCU iron-sulfur cluster assembly enzyme 6 7
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1 like 7 2
MIRT003166 DENND6A DENN domain containing 6A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 5 1
MIRT003168 CDK10 cyclin dependent kinase 10 3 1
MIRT003169 ABCB9 ATP binding cassette subfamily B member 9 3 1
MIRT003170 CBX1 chromobox 1 3 1
MIRT003171 XIST X inactive specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL NIPBL, cohesin loading factor 3 1
MIRT003176 MIB1 mindbomb E3 ubiquitin protein ligase 1 3 1
MIRT003177 HECTD1 HECT domain E3 ubiquitin protein ligase 1 3 1
MIRT003178 ELK3 ELK3, ETS transcription factor 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase phospholipid transporting 11C 3 1
MIRT003183 APC APC, WNT signaling pathway regulator 3 1
MIRT003184 E2F3 E2F transcription factor 3 7 5
MIRT003185 ACVR1B activin A receptor type 1B 2 1
MIRT003916 MRE11A MRE11 homolog, double strand break repair nuclease 2 1
MIRT003917 XPA XPA, DNA damage recognition and repair factor 2 1
MIRT004672 MNT MAX network transcriptional repressor 4 2
MIRT006326 AIFM3 apoptosis inducing factor, mitochondria associated 3 3 2
MIRT006519 CASP8AP2 caspase 8 associated protein 2 4 1
MIRT006663 VMP1 vacuole membrane protein 1 3 2
MIRT006830 TFRC transferrin receptor 3 2
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047006 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT047007 SCN1B sodium voltage-gated channel beta subunit 1 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1
MIRT053179 HSD17B1 hydroxysteroid 17-beta dehydrogenase 1 2 1
MIRT054098 NDUFA4 NDUFA4, mitochondrial complex associated 4 2
MIRT054099 SDHD succinate dehydrogenase complex subunit D 6 4
MIRT054141 STMN1 stathmin 1 3 1
MIRT054142 DIMT1L DIM1 dimethyladenosine transferase 1 homolog 4 2
MIRT054186 ROD1 polypyrimidine tract binding protein 3 3 1
MIRT054203 ALDH5A1 aldehyde dehydrogenase 5 family member A1 4 1
MIRT054204 FOXN3 forkhead box N3 5 2
MIRT054205 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054206 IGFBP3 insulin like growth factor binding protein 3 6 2
MIRT054207 COL4A2 collagen type IV alpha 2 chain 6 2
MIRT054208 INPP5A inositol polyphosphate-5-phosphatase A 4 1
MIRT054209 EHD2 EH domain containing 2 4 1
MIRT054210 SH3BGRL SH3 domain binding glutamate rich protein like 5 2
MIRT054248 PTPN2 protein tyrosine phosphatase, non-receptor type 2 3 1
MIRT054321 LDHA lactate dehydrogenase A 2 1
MIRT054324 LDHB lactate dehydrogenase B 2 1
MIRT054349 HIF1A hypoxia inducible factor 1 alpha subunit 5 2
MIRT054714 FOXP3 forkhead box P3 3 1
MIRT054794 HIF3A hypoxia inducible factor 3 alpha subunit 3 1
MIRT115688 MGRN1 mahogunin ring finger 1 2 3
MIRT170674 INSIG1 insulin induced gene 1 1 1
MIRT437785 BNIP3 BCL2 interacting protein 3 5 2
MIRT438739 KCMF1 potassium channel modulatory factor 1 1 1
MIRT439407 TNPO3 transportin 3 1 1
MIRT439629 SIPA1L3 signal induced proliferation associated 1 like 3 1 1
MIRT439632 SIN3A SIN3 transcription regulator family member A 1 1
MIRT439740 RPL22 ribosomal protein L22 1 1
MIRT439886 PSAP prosaposin 1 1
MIRT439918 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT439928 POU2AF1 POU class 2 associating factor 1 1 1
MIRT440033 ICMT isoprenylcysteine carboxyl methyltransferase 2 3
MIRT440255 MEF2D myocyte enhancer factor 2D 1 1
MIRT440491 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 3
MIRT440570 GIT2 GIT ArfGAP 2 1 1
MIRT440647 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT440830 DEAF1 DEAF1, transcription factor 1 1
MIRT440866 CSNK1E casein kinase 1 epsilon 1 1
MIRT472232 NFIC nuclear factor I C 2 2
MIRT473190 MITF melanogenesis associated transcription factor 2 2
MIRT477856 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT497528 ZNF607 zinc finger protein 607 2 2
MIRT509770 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT524407 CNTNAP5 contactin associated protein like 5 2 4
MIRT535209 PKIA cAMP-dependent protein kinase inhibitor alpha 2 4
MIRT554511 RUNX1T1 RUNX1 translocation partner 1 2 4
MIRT558069 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 2 2
MIRT572273 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT574255 DOCK7 dedicator of cytokinesis 7 2 4
MIRT575621 Foxn3 forkhead box N3 2 2
MIRT575742 Zfp618 zinc finger protein 618 1 1
MIRT609050 VAMP4 vesicle associated membrane protein 4 2 2
MIRT611143 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT699226 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT703060 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT716005 ASB11 ankyrin repeat and SOCS box containing 11 2 2
MIRT731682 BTK Bruton tyrosine kinase 3 1
MIRT733090 DLEU2L deleted in lymphocytic leukemia 2-like 3 0
MIRT733091 BRCA2 BRCA2, DNA repair associated 3 0
MIRT733156 ITGA5 integrin subunit alpha 5 1 0
MIRT733501 GATA1 GATA binding protein 1 3 0
MIRT733503 SMAD2 SMAD family member 2 3 0
MIRT733525 MIR210HG MIR210 host gene 2 0
MIRT733615 TGFBI transforming growth factor beta induced 2 0
MIRT734175 KRAS KRAS proto-oncogene, GTPase 2 0
MIRT734293 PTEN phosphatase and tensin homolog 1 0
MIRT734568 STAT6 signal transducer and activator of transcription 6 1 0
MIRT734966 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif 6 1 0
MIRT736294 ID2 inhibitor of DNA binding 2, HLH protein 1 0
MIRT737104 FABP4 fatty acid binding protein 4, adipocyte 3 0
MIRT756028 NTN4 netrin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-210 Vincristine approved 5978 Quantitative real-time PCR Hep-2 cells 23780424 2013 up-regualted
miR-210 Lenalidomide approved 216326 Quantitative real-time PCR peripheral blood CD14+ monocytes 25287904 2014 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray lymphoblast cell line TK-6 17108120 2006 down-regulated
miR-210 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-210 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-210 Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 down-regulated
miR-210 Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-210 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-210 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-210 Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miR-210 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-210 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-210 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-210 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-210 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-210 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-210 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-210-3p (E)-1-[3,5-bis[(dimethylamino)methyl]-4-hydroxyphenyl]-3-phenylprop-2-en-1-one 6374691 NSC677784 resistant
hsa-miR-210-3p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 resistant
hsa-miR-210-3p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 resistant
hsa-miR-210-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-210-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-copper; 2-(2-pyridyl)pyridine 135484845 NSC638302 resistant
hsa-miR-210-3p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 sensitive
hsa-miR-210-3p 1-(4-nitrophenyl)-3-(2-pyridyl)thiourea 3005383 NSC695329 sensitive
hsa-miR-210-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 resistant
hsa-miR-210-3p 1-[2-(4-nitrophenyl)-2-oxoethyl]-4-pentylpyridin-1-ium bromide 24181037 NSC4290 resistant
hsa-miR-210-3p 11-(3-methoxyphenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608964 NSC697747 resistant
hsa-miR-210-3p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-210-3p 1h-benz[g]indol-5-ol, 2-phenyl 371327 NSC645431 resistant
hsa-miR-210-3p 2-[[4-anilino-5-[8-[4-anilino-5-[(1-hydroxynaphthalen-2-yl)oxymethyl]-1,2,4-triazol-3-yl]octyl]-1,2,4-triazol-3-yl]methoxy]naphthalen-1-ol 394049 NSC697167 resistant
hsa-miR-210-3p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 resistant
hsa-miR-210-3p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-210-3p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 sensitive
hsa-miR-210-3p 2-hydroxy-5-({(e)-[(10-hydroxyacridin-9(10h)-ylidene)methyl]diazenyl}sulfonyl)benzoic acid 363212 NSC627890 resistant
hsa-miR-210-3p 3'-chloro-3-nitro-o-salicylotoluidide 332278 NSC328477 resistant
hsa-miR-210-3p 3-((4-(methylthio)phenoxy)methyl)-2-oxiranol 366923 NSC636087 resistant
hsa-miR-210-3p 4-(2-phenylethylamino)naphthalene-1,2-dione 367789 NSC637731 resistant
hsa-miR-210-3p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 resistant
hsa-miR-210-3p 4-[(r)-[(2s,5r)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-n-pentan-3-ylbenzamide;hydrochloride 5471112 NSC708822 resistant
hsa-miR-210-3p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-210-3p 4-[4-(4-sulfinobutyldisulfanyl)butyldisulfanyl]butane-1-sulfinic acid 361262 NSC624205 resistant
hsa-miR-210-3p 4-acetamido-n-[(e)-(2,4-dichlorophenyl)methylideneamino]-2-methoxybenzamide 9572428 NSC716142 sensitive
hsa-miR-210-3p 4-aminodithiolane-4-carboxylic acid 269217 NSC109825 resistant
hsa-miR-210-3p 4-hydroxy-3-[1-(1-hydroxy-3,4-dioxonaphthalen-2-yl)-3-phenylpropyl]naphthalene-1,2-dione 272651 NSC117274 resistant
hsa-miR-210-3p 4,4-dimethylspiro[1,3,2-oxazaphospholidin-2-ium-2,2'-3h-1,3,2-benzoxazaphosphol-2-ium]-5-one 6330525 NSC351866 resistant
hsa-miR-210-3p 4b-hydroxy-10,10-dimethoxy-9ah-indeno[1,2-a]inden-9-one 363252 NSC628000 resistant
hsa-miR-210-3p 4h,7h-furo[2',3',4':4,5]naphth[2,1-e][1,3]oxazin-4-one, 8-(4-chlorophenyl)-8,9-dihydro- 373969 NSC651001 resistant
hsa-miR-210-3p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-210-3p 6-(3-chloropropyl)-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 17755848 NSC731154 resistant
hsa-miR-210-3p 6-benzyloxyhexanal 389877 NSC686505 resistant
hsa-miR-210-3p 7-[(E)-2-(1,6-dimethylquinolin-1-ium-2-yl)ethenyl]-5-methylquinolin-8-ol 135483953 NSC86371 resistant
hsa-miR-210-3p 7-[(naphthalen-1-ylamino)(phenyl)methyl]quinolin-8-ol 256754 NSC84092 resistant
hsa-miR-210-3p 7-chloro-6-n-(2-fluoroethylamino)-5,8-quinolinedione 379079 NSC663286 resistant
hsa-miR-210-3p 7-o,8-o-isopropylidene iriomoteolide 3a 24808220 NSC753164 resistant
hsa-miR-210-3p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 2-phenyl- 4567749 NSC686553 resistant
hsa-miR-210-3p Acetyltrophanthidin 261075 NSC92954 resistant
hsa-miR-210-3p Adenosine, 2-bromo-2'-deoxy- 334838 NSC341936 resistant
hsa-miR-210-3p Asimicinone 393461 NSC695394 resistant
hsa-miR-210-3p Benzo[b]naphtho[2,3-d]furan-6,11-dione, 4-chloro-3-hydroxy 371025 NSC644902 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(2,4-dimethylphenyl)-3-methyl- 363228 NSC627974 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(4-chlorophenyl)-3,7,8-trimethyl- 363246 NSC627992 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 3-methyl-10-[3-(methylthio)phenyl]- 363242 NSC627988 resistant
hsa-miR-210-3p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 resistant
hsa-miR-210-3p Celcot rm 67277 NSC37168 resistant
hsa-miR-210-3p Cytarabine 6253 NSC287459 approved resistant
hsa-miR-210-3p Destruxin a 122810 NSC361126 resistant
hsa-miR-210-3p Di-p-tolyliodinium bromide 54601177 NSC8985 resistant
hsa-miR-210-3p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 resistant
hsa-miR-210-3p Dihydrorotenone 243725 NSC53866 resistant
hsa-miR-210-3p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-210-3p Discorhabdin i 135409047 NSC656206 resistant
hsa-miR-210-3p Dpbq 364074 NSC629713 resistant
hsa-miR-210-3p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 resistant
hsa-miR-210-3p Ethyl 6-hydroxy-4-(4-methoxyphenyl)-6-methyl-3-oxo-2-phenyl-1,4,5,7-tetrahydroindazole-5-carboxylate 392845 NSC693857 resistant
hsa-miR-210-3p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 sensitive
hsa-miR-210-3p Gw612286x 9822610 NSC756278 sensitive
hsa-miR-210-3p Gw811761x 6539382 NSC756375 sensitive
hsa-miR-210-3p Herbimycin 6436247 NSC305978 resistant
hsa-miR-210-3p Hypothemycin 5458809 NSC354462 resistant
hsa-miR-210-3p Indole-2,3-dione, 5-methyl-, 3-[(o-nitrophenyl)hydrazone] 3632950 NSC117915 sensitive
hsa-miR-210-3p J3.572.907k 396709 NSC703318 resistant
hsa-miR-210-3p Methyl 10-acetyl-3-(4-methylphenyl)sulfonyl-9-(2-methylprop-1-enyl)-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13),11-pentaene-11-carboxylate NSC621968 resistant
hsa-miR-210-3p Methyl 8-[(4-chlorophenyl)carbamoyl]naphthalene-1-carboxylate 364289 NSC630307 resistant
hsa-miR-210-3p N-(2-morpholin-4-ylethyl)-5-nitroquinolin-4-amine;hydrochloride 372042 NSC646859 resistant
hsa-miR-210-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 resistant
hsa-miR-210-3p N-(3,5-dicyano-2-(4-methylphenyl)-6-oxo-4-phenyl-1(6h)-pyridinyl)-4-methylbenzenesulfonamide 390286 NSC687578 resistant
hsa-miR-210-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 resistant
hsa-miR-210-3p N-[1,1,1,3,3,3-hexafluoro-2-(4-fluoroanilino)propan-2-yl]butanamide 389152 NSC684836 resistant
hsa-miR-210-3p Naphtho[2,3-d]-1,3-dioxepin-6,11-dione, 4-methyl- NSC626868 resistant
hsa-miR-210-3p Naphtho[2,3-d]oxazole-4,9-dione, 2-(1,1-dimethylethyl)- 370622 NSC643915 resistant
hsa-miR-210-3p Niosh/br9826000 359483 NSC620462 resistant
hsa-miR-210-3p NSC619321 NSC619321 sensitive
hsa-miR-210-3p NSC621321 NSC621321 resistant
hsa-miR-210-3p NSC631451 NSC631451 resistant
hsa-miR-210-3p NSC634766 NSC634766 resistant
hsa-miR-210-3p NSC635414 NSC635414 resistant
hsa-miR-210-3p Pentyl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402498 NSC716524 resistant
hsa-miR-210-3p Pmp (van) 72508 NSC1906 resistant
hsa-miR-210-3p Scillirosidin, glycoside 222160 NSC7534 resistant
hsa-miR-210-3p Sesbanimide 163490 NSC355461 resistant
hsa-miR-210-3p Snc 80 123924 NSC707484 resistant
hsa-miR-210-3p Streptovaricin b 135443622 NSC156215 resistant
hsa-miR-210-3p Tetratert-butyl 8,11-dimethoxytricyclo[4.3.3.01,6]dodeca-7,10-diene-7,9,10,12-tetracarboxylate 362411 NSC626176 resistant
hsa-miR-210-3p Tolonium chloride 7083 NSC36758 resistant
hsa-miR-210-3p Z48861686 4784054 NSC745813 resistant
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Trastuzumab resistant Low Breast Cancer tissue and cell line (BT-474, BTR65)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant Low Cervical Cancer tissue and cell line (SiHa, Cask)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-210-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (DU-145)
hsa-miR-210-3p Asparaginate 5460875 sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive High Myeloma cell line (MM1R, MM1S)
hsa-miR-210-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive High Acute Myeloid Leukemia cell line (U-937, KG-1)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (MIA-PaCa-2)
hsa-miR-210-3p Trametinib 11707110 NSC758246 approved sensitive Low Melanoma cell line (MML-1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-210-3p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p 1'-Acetoxychavicol acetate 119104 NSC711510 resistant Low Cervical Cancer cell line (Ca Ski, SiHa)
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Vinblastine 442111 NSC90636 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Cancer cell line (LS174T)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Cholangiocarcinoma cell line (KKU-213, KKU-055, KKU-100)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue
hsa-miR-210-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (T47D)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) sensitive High Metastatic Colorectal Cancer tissue
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (BXPC-3)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, HSC-3, HSC-4)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia tissue
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer tissue
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant Low Glioma cell line (U87)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-210-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (PLC/PRF5-R1, PLC/PRF5-R2, PLC/PRF5)
hsa-miR-210-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-210-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-210-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-210-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-210-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR8)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-210-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission