miRTarBase - #MIRT705073


—
pre-miRNA Information
pre-miRNA hsa-mir-4281   
Genomic Coordinates chr5: 176629439 - 176629500
Description Homo sapiens miR-4281 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4281
Sequence 35| GGGUCCCGGGGAGGGGGG |52
Evidence Experimental
Experiments SOLiD
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs921488943 1 dbSNP
rs1040286402 3 dbSNP
rs1375541904 8 dbSNP
rs759166911 12 dbSNP
rs768735686 13 dbSNP
rs746495416 14 dbSNP
rs779751131 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C4orf29
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggGGG--GAGGGGCCCUggg 5'
            |||  | |:::||||   
Target 5' auCCCAGCACUUUGGGAggc 3'
 		3 - 22
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000388795.5 | 3UTR | UAAUCCCAGCACUUUGGGAGGCCGAGGUGGGGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
29 hsa-miR-4281 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT218864 CDKN1A cyclin dependent kinase inhibitor 1A 2 4
MIRT248841 SESN2 sestrin 2 2 2
MIRT452803 PACS2 phosphofurin acidic cluster sorting protein 2 2 2
MIRT462825 BCL3 B-cell CLL/lymphoma 3 2 2
MIRT467812 SLC29A2 solute carrier family 29 member 2 2 2
MIRT477707 EFHD2 EF-hand domain family member D2 2 2
MIRT490047 PRRT2 proline rich transmembrane protein 2 2 2
MIRT491813 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT528905 THBS2 thrombospondin 2 2 2
MIRT534124 SNX33 sorting nexin 33 2 2
MIRT550881 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT551263 PSMG1 proteasome assembly chaperone 1 2 2
MIRT551984 UGT2B10 UDP glucuronosyltransferase family 2 member B10 2 2
MIRT608916 NCDN neurochondrin 2 6
MIRT637226 TMEM59 transmembrane protein 59 2 2
MIRT644445 ALDOC aldolase, fructose-bisphosphate C 2 2
MIRT657162 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT658754 ELAVL3 ELAV like RNA binding protein 3 2 2
MIRT668304 FOSL2 FOS like 2, AP-1 transcription factor subunit 2 2
MIRT687548 MLEC malectin 2 2
MIRT690860 PLEKHG2 pleckstrin homology and RhoGEF domain containing G2 2 2
MIRT697063 PSMC4 proteasome 26S subunit, ATPase 4 2 2
MIRT700860 PER2 period circadian clock 2 2 2
MIRT705073 C4orf29 abhydrolase domain containing 18 2 2
MIRT713930 PIGR polymeric immunoglobulin receptor 2 2
MIRT715904 MFRP membrane frizzled-related protein 2 2
MIRT716060 SFTPB surfactant protein B 2 2
MIRT716729 APOL6 apolipoprotein L6 2 2
MIRT723382 NFAM1 NFAT activating protein with ITAM motif 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miR-4281 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4281 Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4281 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4281 Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (PLX4032, LM16)
hsa-miR-4281 Cisplatin 5460033 NSC119875 approved resistant High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-4281 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375)
hsa-miR-4281 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4281 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H460)
hsa-mir-4281 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4281 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-mir-4281 Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-mir-4281 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-mir-4281 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-4281 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-4281 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4281 Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-4281 Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-4281 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-4281 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-4281 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-4281 Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-4281 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-4281 Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-4281 Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-miR-4281 Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission