pre-miRNA Information
pre-miRNA hsa-let-7e   
Genomic Coordinates chr19: 51692786 - 51692864
Synonyms MIRNLET7E, hsa-let-7e, let-7e, MIRLET7E
Description Homo sapiens let-7e stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-let-7e-5p
Sequence 8| UGAGGUAGGAGGUUGUAUAGUU |29
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1189776118 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol AMD1   
Synonyms ADOMETDC, AMD, SAMDC
Description adenosylmethionine decarboxylase 1
Transcript NM_001634   
Expression
Putative miRNA Targets on AMD1
3'UTR of AMD1
(miRNA target sites are highlighted)
>AMD1|NM_001634|3'UTR
   1 TTAAGAAAAATGAAGAAAAAACGCAAAAAGAGAACACATGTAGAAGGTGGTGGATGCTTTCTAGATGTCGATGCTGGGGG
  81 CAGTGCTTTCCATAACCACCACTGTGTAGTTGCAGAAAGCCCTAGATGTAATGATAGTGTAATCATTTTGAATTGTATGC
 161 ATTATTATATCAAGGAGTTAGATATCTTGCATGAATGCTCTCTTCTGTGTTTAGGTATTCTCTGCCACTCTTGCTGTGAA
 241 ATTGAAGTGCATGTAGAAAAAACCTTTTACTATATGAAACTTTACAACACTTGTGAAAGCAACTCAATTTGGTTTATGCA
 321 CAGTGTAATATTTCTCCAAGTATCATCCAAAATTCCCCACAGACAAGGCTTTCGTCCTCATTAGGTGTTGGCCTCAGCCT
 401 AACCCTCTAGGACTGTTCTATTAAATTGCTGCCAGAATTTTACATCCAGTTACCTCCACTTTCTAGAACATATTCTTTAC
 481 TAATGTTATTGAAACCAATTTCTACTTCATACTGATGTTTTTGGAAACAGCAATTAAAGTTTTTCTTCCATGAGTTGAGT
 561 CCTTAAGAAAATGATTCCAGTTACTCATTTTGCATATTTGCTATTTTAACATTATTGGACCCTGCATTTATAGTCCTTTG
 641 ATTTCTTCCCTCTCCCTGGTGTCTCCCCCAAGACCCCAAATAAAGCAATACACTGTTAACACTGTGGGTTTATATACTAA
 721 TTCTATACCCCAGATGGGGAATGGGGGAGATGGTCCCTGGGCTTAATATTCTTTAAAGGGCATGGGAATTTAGCCTCTCT
 801 TTTATTGTAATGTGCTCTTTTGGAAAATAGTTGGTTAGCAGGGAAGACCCAGAGTTGTAGATTGAGATTAGGGTGTACTG
 881 GCTGAACTGTGGAAAACATACAATTCTGTGTTCCTCAGTAAATGAGATTAGCGTCTAATGAGTAGCACCCCTTTACTAAC
 961 TTAGTAGTAGTATAAAATCATTTTTATTTAGTTAATTACCAGAGAGATTTAGCATAATTTTGTTCTGGATTCAGTAAATC
1041 AAGTCAGCTTGGATCATTCACCTTAACTTTTCCTTTAGCAGCCATTTCCACTAGTTTCCATTAAGTAGTGTTCTATAAAC
1121 TTTGATCCAAAGCAGAATCAATGTCTTTTCCATCTCGTGACTTAAAGTTCTGTGACTGTGATGCATGTGAGTGTTCCGAC
1201 TTCATCTGTTCCTCTTAACTACGGTGTTTCCCTTACCATGGCATTCATAGGATGAAATGAATGACTGCCCAGAATGAGAA
1281 TTTGTCCAGATTATTCAGATAAACATCATAAAGCAGAATACATTATAAATAAGTAGAATATGAATAAATAGAATAATAAA
1361 ATTCCAAAATACTCAATGGGAAATGACTAGTAATATAGGCTTTCAAGAGTTGGTACCTTTTAGCTATATTTGCAGATTCT
1441 CTGGGATTTTAAGGAACTGAGAAAACAGCAAAGTTGACTAAATTTTATATTTCTTGTCCTCTAAATATTTTGATAATTTC
1521 TGGATTGATGCAGTGATGTTTTTGTTCCTTCCGTATTTATAAATGAAACACCTTTTTTTAGTGTTTCTAAACCTAAAATC
1601 TACTTGGTTTGAAATCAAGTGGTTGGAACACTGTTTGACTTTTATTTGAAGCATGTTGTTGATTGAAAATTTCATTGAGG
1681 AAGTTTTCAATCAGTGTGATCAGTTTGATTCTGTAATGAGCACAGCACCTAATATTTTGAGGAGCTCTGTTTTGAGGACC
1761 AATGCTTAAGGTGGACTTTGTTCGTAAACAATATCCCAATAGATTTGTTGACTTGAGGTCTGGTTTGGTTTTGTTTTTGT
1841 TTTGTTTTGTTTTGTTTTGTTTCCAATAGAATTAAGAATTCTAATGTTGAAAAACTGCACAAATTTTTATGGGACAAAGC
1921 CTAGAAAAGAGAAATGTAGTTTGAATCATAATCTAAATCATCGTATGATAGAAGAGGGAAAGTTTTGGTGCCATAATTTC
2001 TCCTTTCACTGGTGTTGGACTTAAATCAGTTGAAATGTATTTCTGTACCACAATTTACGCTTCAATAAAAGTTTAATTGT
2081 CTAGTGACATTCAGAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uuGAUAUGUUGGAGGAUGGAGu 5'
            :| |||| ||  :|||||| 
Target 5' aaTTTTACATCCAGTTACCTCc 3'
436 - 457 148.00 -14.30
2
miRNA  3' uuGAU-AUGUUGG---AGGAUGGAGu 5'
            :|| |: ||||   |:||||:|| 
Target 5' tgTTATTGAAACCAATTTCTACTTCa 3'
484 - 509 144.00 -15.00
3
miRNA  3' uuGAUAUGUUGGA----GGAUGGAgu 5'
            :| || |||||    :||||:|  
Target 5' gtTTCTA-AACCTAAAATCTACTTgg 3'
1583 - 1607 121.00 -9.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30518593 22 COSMIC
COSN31532367 23 COSMIC
COSN30126947 24 COSMIC
COSN26965885 30 COSMIC
COSN30488038 30 COSMIC
COSN14931434 61 COSMIC
COSN30111882 71 COSMIC
COSN30522243 82 COSMIC
COSN1322998 185 COSMIC
COSN30172663 187 COSMIC
COSN31562043 343 COSMIC
COSN26636106 369 COSMIC
COSN26563929 388 COSMIC
COSN28406119 636 COSMIC
COSN8792006 745 COSMIC
COSN30540108 756 COSMIC
COSN1322999 1122 COSMIC
COSN26043215 1828 COSMIC
COSN15852371 1835 COSMIC
COSN31549494 1877 COSMIC
COSN31538721 1986 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1429966634 4 dbSNP
rs1436910192 12 dbSNP
rs1168811114 16 dbSNP
rs1300971074 16 dbSNP
rs1389070683 21 dbSNP
rs746387074 22 dbSNP
rs1165468778 23 dbSNP
rs537141501 24 dbSNP
rs1435603289 25 dbSNP
rs760204349 28 dbSNP
rs1397007659 29 dbSNP
rs755233430 32 dbSNP
rs768244769 33 dbSNP
rs781093042 36 dbSNP
rs1233850268 40 dbSNP
rs761580615 42 dbSNP
rs765085737 45 dbSNP
rs750169805 52 dbSNP
rs986148266 53 dbSNP
rs1159272784 54 dbSNP
rs1473492721 59 dbSNP
rs1803096 61 dbSNP
rs1424157986 65 dbSNP
rs567501867 66 dbSNP
rs1036272737 71 dbSNP
rs1464663590 76 dbSNP
rs536571911 76 dbSNP
rs553267344 78 dbSNP
rs1341983676 79 dbSNP
rs113377358 81 dbSNP
rs1048852607 87 dbSNP
rs1278283131 90 dbSNP
rs756525090 93 dbSNP
rs370858422 96 dbSNP
rs1342631302 103 dbSNP
rs1293949286 105 dbSNP
rs1205119182 109 dbSNP
rs1387455025 112 dbSNP
rs1320590216 128 dbSNP
rs1001871868 129 dbSNP
rs1458375793 138 dbSNP
rs112207637 139 dbSNP
rs1056067425 151 dbSNP
rs1162557414 160 dbSNP
rs1458410957 168 dbSNP
rs1369967498 170 dbSNP
rs896147286 177 dbSNP
rs113835204 183 dbSNP
rs1449021246 186 dbSNP
rs1014957867 197 dbSNP
rs1190537256 200 dbSNP
rs1467177622 201 dbSNP
rs1020515107 204 dbSNP
rs1263277261 205 dbSNP
rs1464026024 207 dbSNP
rs967976789 216 dbSNP
rs1359090157 223 dbSNP
rs1249906771 230 dbSNP
rs1227190335 233 dbSNP
rs1000376782 235 dbSNP
rs1297844936 244 dbSNP
rs186209197 248 dbSNP
rs1475662046 252 dbSNP
rs1033155577 258 dbSNP
rs1322373996 288 dbSNP
rs1387223830 292 dbSNP
rs953444611 293 dbSNP
rs1165900261 294 dbSNP
rs115794151 297 dbSNP
rs558779631 303 dbSNP
rs1452869989 304 dbSNP
rs1468475669 305 dbSNP
rs1246141040 307 dbSNP
rs568620465 308 dbSNP
rs1407007401 317 dbSNP
rs1249060367 325 dbSNP
rs1317298930 329 dbSNP
rs1400182468 340 dbSNP
rs1227363680 342 dbSNP
rs966055108 356 dbSNP
rs1316244890 361 dbSNP
rs543927301 369 dbSNP
rs972421069 371 dbSNP
rs1436613485 372 dbSNP
rs749613870 374 dbSNP
rs771477431 375 dbSNP
rs930538480 376 dbSNP
rs1328716253 378 dbSNP
rs1409178429 394 dbSNP
rs554574836 404 dbSNP
rs1309636231 407 dbSNP
rs1180404684 410 dbSNP
rs1433019456 413 dbSNP
rs926426426 419 dbSNP
rs1283068755 420 dbSNP
rs937798172 421 dbSNP
rs1182087856 423 dbSNP
rs2298886 427 dbSNP
rs1225010154 433 dbSNP
rs1254351055 437 dbSNP
rs1209186063 443 dbSNP
rs1283508273 447 dbSNP
rs762478165 448 dbSNP
rs896162468 455 dbSNP
rs1346468804 460 dbSNP
rs1285976848 463 dbSNP
rs1227649072 464 dbSNP
rs1202859776 466 dbSNP
rs1285700326 469 dbSNP
rs539827515 474 dbSNP
rs1220705087 477 dbSNP
rs1358407997 490 dbSNP
rs1266554427 496 dbSNP
rs1335064550 502 dbSNP
rs1042415422 504 dbSNP
rs1382868284 508 dbSNP
rs1158540957 510 dbSNP
rs1481291058 535 dbSNP
rs1473169304 541 dbSNP
rs1414881973 549 dbSNP
rs1049747 550 dbSNP
rs559648638 552 dbSNP
rs903452901 569 dbSNP
rs1201941740 573 dbSNP
rs745551987 574 dbSNP
rs1238455167 579 dbSNP
rs1210383464 581 dbSNP
rs1430264184 583 dbSNP
rs1265622686 585 dbSNP
rs1207590678 587 dbSNP
rs982968198 594 dbSNP
rs1156934738 595 dbSNP
rs1378161616 601 dbSNP
rs1387169701 602 dbSNP
rs1401846202 603 dbSNP
rs1303044981 604 dbSNP
rs763869562 604 dbSNP
rs1363296974 611 dbSNP
rs771878000 617 dbSNP
rs908818820 631 dbSNP
rs1364172293 651 dbSNP
rs1407159649 653 dbSNP
rs940316254 660 dbSNP
rs1056124685 662 dbSNP
rs774813770 663 dbSNP
rs1405365323 666 dbSNP
rs1284250827 668 dbSNP
rs1334835191 669 dbSNP
rs1414901994 677 dbSNP
rs751054358 694 dbSNP
rs889278681 703 dbSNP
rs947811952 712 dbSNP
rs878983501 723 dbSNP
rs771394131 726 dbSNP
rs1464928306 729 dbSNP
rs1269544457 732 dbSNP
rs1350721534 734 dbSNP
rs1321065523 735 dbSNP
rs1019016954 736 dbSNP
rs1289484782 743 dbSNP
rs1340247128 744 dbSNP
rs936505433 746 dbSNP
rs1367438589 748 dbSNP
rs368722674 758 dbSNP
rs11549420 761 dbSNP
rs1222963893 762 dbSNP
rs892392854 772 dbSNP
rs1250751423 774 dbSNP
rs34130209 784 dbSNP
rs1437487740 787 dbSNP
rs1351006531 795 dbSNP
rs9481126 796 dbSNP
rs1428194973 804 dbSNP
rs1365649487 811 dbSNP
rs527686855 815 dbSNP
rs951973806 816 dbSNP
rs1249287398 818 dbSNP
rs1019611716 822 dbSNP
rs1488096449 827 dbSNP
rs899855590 829 dbSNP
rs1162944881 834 dbSNP
rs761323907 839 dbSNP
rs746542710 859 dbSNP
rs926498460 876 dbSNP
rs1027040848 878 dbSNP
rs1007163002 881 dbSNP
rs1229396121 888 dbSNP
rs1427066158 891 dbSNP
rs1304154486 896 dbSNP
rs1396193260 898 dbSNP
rs1344587588 899 dbSNP
rs1299230634 900 dbSNP
rs1389356820 901 dbSNP
rs1330466879 902 dbSNP
rs565294437 904 dbSNP
rs1368459689 912 dbSNP
rs937826065 914 dbSNP
rs1335891088 921 dbSNP
rs992344876 933 dbSNP
rs41289880 934 dbSNP
rs1429923800 936 dbSNP
rs55983649 950 dbSNP
rs945094234 952 dbSNP
rs1173288349 956 dbSNP
rs1432074333 958 dbSNP
rs1361548835 959 dbSNP
rs1042058635 968 dbSNP
rs1482067530 973 dbSNP
rs903487021 974 dbSNP
rs550769056 977 dbSNP
rs1246566498 979 dbSNP
rs1484129916 988 dbSNP
rs1254461840 999 dbSNP
rs1209731083 1000 dbSNP
rs1312837713 1002 dbSNP
rs1303569020 1036 dbSNP
rs1227030274 1037 dbSNP
rs750957982 1037 dbSNP
rs776696839 1039 dbSNP
rs1054708830 1042 dbSNP
rs1289335761 1043 dbSNP
rs1250598110 1060 dbSNP
rs1337169085 1061 dbSNP
rs889317779 1062 dbSNP
rs1465293485 1067 dbSNP
rs567665486 1067 dbSNP
rs1252914202 1077 dbSNP
rs1262886751 1079 dbSNP
rs1007740779 1083 dbSNP
rs1019507794 1105 dbSNP
rs530149124 1108 dbSNP
rs993957709 1111 dbSNP
rs1182869738 1116 dbSNP
rs1026351458 1128 dbSNP
rs369941943 1132 dbSNP
rs546991779 1135 dbSNP
rs1483707309 1137 dbSNP
rs984697463 1142 dbSNP
rs1206942474 1146 dbSNP
rs1329027147 1155 dbSNP
rs1269300314 1158 dbSNP
rs1164735038 1160 dbSNP
rs1033542384 1164 dbSNP
rs1372930992 1165 dbSNP
rs761575446 1192 dbSNP
rs1460772330 1193 dbSNP
rs756451250 1194 dbSNP
rs1395033004 1198 dbSNP
rs1338067926 1199 dbSNP
rs992022000 1201 dbSNP
rs917701469 1205 dbSNP
rs1159806645 1210 dbSNP
rs566817889 1212 dbSNP
rs780251093 1213 dbSNP
rs945154282 1217 dbSNP
rs1366437019 1222 dbSNP
rs1451414890 1223 dbSNP
rs754296602 1224 dbSNP
rs1334150721 1225 dbSNP
rs1384337205 1231 dbSNP
rs1245228941 1233 dbSNP
rs1453338202 1233 dbSNP
rs139121730 1237 dbSNP
rs558722608 1249 dbSNP
rs1294767527 1258 dbSNP
rs1459733522 1261 dbSNP
rs1248798213 1266 dbSNP
rs1324529543 1270 dbSNP
rs978237570 1275 dbSNP
rs1354878469 1288 dbSNP
rs568932520 1293 dbSNP
rs1229343614 1320 dbSNP
rs924978975 1321 dbSNP
rs1323928395 1322 dbSNP
rs115382800 1325 dbSNP
rs1318900934 1326 dbSNP
rs1049396222 1334 dbSNP
rs1383781885 1340 dbSNP
rs1388528492 1343 dbSNP
rs910825926 1343 dbSNP
rs943579263 1358 dbSNP
rs36095632 1364 dbSNP
rs1261379746 1371 dbSNP
rs554404357 1373 dbSNP
rs1449155999 1376 dbSNP
rs1183009091 1380 dbSNP
rs1390804273 1381 dbSNP
rs1195425288 1386 dbSNP
rs1450353563 1388 dbSNP
rs781194 1393 dbSNP
rs1427191251 1395 dbSNP
rs1490941519 1396 dbSNP
rs1273005062 1397 dbSNP
rs902003253 1402 dbSNP
rs1341019880 1418 dbSNP
rs993638093 1428 dbSNP
rs1229000191 1429 dbSNP
rs111595794 1431 dbSNP
rs759709419 1435 dbSNP
rs1195826247 1436 dbSNP
rs1387352994 1442 dbSNP
rs1367192673 1455 dbSNP
rs1305970381 1458 dbSNP
rs1047786992 1463 dbSNP
rs1169915843 1470 dbSNP
rs1391055144 1470 dbSNP
rs1477062885 1478 dbSNP
rs1373949561 1490 dbSNP
rs1200184157 1500 dbSNP
rs1481710895 1502 dbSNP
rs1469016978 1510 dbSNP
rs1249979494 1520 dbSNP
rs534715104 1545 dbSNP
rs887806479 1553 dbSNP
rs150874634 1554 dbSNP
rs1197227248 1560 dbSNP
rs1342260374 1571 dbSNP
rs1469857297 1573 dbSNP
rs1223981934 1579 dbSNP
rs1287722948 1581 dbSNP
rs1382736662 1582 dbSNP
rs1383800076 1584 dbSNP
rs868572880 1586 dbSNP
rs1296086570 1588 dbSNP
rs1006189579 1592 dbSNP
rs1033614371 1596 dbSNP
rs959318736 1601 dbSNP
rs1370980576 1603 dbSNP
rs1331125081 1604 dbSNP
rs1223196742 1609 dbSNP
rs1401514675 1612 dbSNP
rs1013886099 1619 dbSNP
rs1325853178 1631 dbSNP
rs1182150627 1632 dbSNP
rs1473107178 1641 dbSNP
rs1210912660 1654 dbSNP
rs1183518803 1673 dbSNP
rs1440353912 1676 dbSNP
rs1260181221 1680 dbSNP
rs1277216289 1687 dbSNP
rs11549421 1689 dbSNP
rs200514623 1693 dbSNP
rs1266130123 1710 dbSNP
rs977891876 1713 dbSNP
rs1480312207 1714 dbSNP
rs1281080510 1732 dbSNP
rs1446006938 1733 dbSNP
rs1340129570 1737 dbSNP
rs369308825 1752 dbSNP
rs1470983571 1758 dbSNP
rs957752130 1763 dbSNP
rs1433366786 1765 dbSNP
rs1157759526 1784 dbSNP
rs112172975 1785 dbSNP
rs1161837162 1791 dbSNP
rs545248783 1792 dbSNP
rs1236560365 1797 dbSNP
rs1289366779 1800 dbSNP
rs1183875414 1804 dbSNP
rs1364793518 1806 dbSNP
rs1402881896 1813 dbSNP
rs1207965083 1818 dbSNP
rs1317445870 1823 dbSNP
rs1041026837 1828 dbSNP
rs1286038361 1828 dbSNP
rs943670605 1828 dbSNP
rs1347656502 1829 dbSNP
rs1454847524 1829 dbSNP
rs1363102914 1832 dbSNP
rs923488935 1833 dbSNP
rs1432030065 1834 dbSNP
rs868062079 1834 dbSNP
rs147095707 1835 dbSNP
rs538910759 1835 dbSNP
rs865847830 1835 dbSNP
rs879000741 1835 dbSNP
rs879225549 1835 dbSNP
rs929453063 1835 dbSNP
rs1387711810 1838 dbSNP
rs200800942 1839 dbSNP
rs74922286 1840 dbSNP
rs766436968 1840 dbSNP
rs1486125471 1841 dbSNP
rs1243752753 1843 dbSNP
rs1219330465 1845 dbSNP
rs1047855513 1849 dbSNP
rs887879975 1850 dbSNP
rs1006220567 1855 dbSNP
rs1340307682 1858 dbSNP
rs1315173758 1860 dbSNP
rs1241893288 1866 dbSNP
rs1287354547 1871 dbSNP
rs1215267601 1890 dbSNP
rs1490313547 1895 dbSNP
rs1364235866 1899 dbSNP
rs1049808 1900 dbSNP
rs565494781 1903 dbSNP
rs1366517729 1907 dbSNP
rs1305341302 1909 dbSNP
rs1271435157 1912 dbSNP
rs895129682 1927 dbSNP
rs1368338146 1936 dbSNP
rs1488630682 1936 dbSNP
rs1013542940 1954 dbSNP
rs1176236035 1959 dbSNP
rs1189386996 1961 dbSNP
rs41289882 1963 dbSNP
rs1269253395 1967 dbSNP
rs966596882 1969 dbSNP
rs868143595 1973 dbSNP
rs1482171041 1977 dbSNP
rs1274167350 1985 dbSNP
rs1205543209 1989 dbSNP
rs150036039 1991 dbSNP
rs1175498834 1993 dbSNP
rs540686668 1994 dbSNP
rs957782561 2004 dbSNP
rs1346726267 2008 dbSNP
rs1285529893 2023 dbSNP
rs561251063 2026 dbSNP
rs985201992 2029 dbSNP
rs910931144 2031 dbSNP
rs1355716603 2038 dbSNP
rs530212732 2049 dbSNP
rs965400994 2053 dbSNP
rs1469192820 2054 dbSNP
rs1158658912 2060 dbSNP
rs56324613 2062 dbSNP
rs976392655 2066 dbSNP
rs923530847 2067 dbSNP
rs547055071 2070 dbSNP
rs1422621576 2071 dbSNP
rs1481741430 2073 dbSNP
rs1254282679 2075 dbSNP
rs1209527923 2082 dbSNP
rs929549240 2084 dbSNP
rs983584735 2085 dbSNP
rs1227162895 2089 dbSNP
rs1350238617 2090 dbSNP
rs952860244 2098 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Hela
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control ...

- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' uugauAUGUUGGAGGAUGGAGu 5'
               |::||||| ||||||| 
Target 5' --cacUGUAACCU-CUACCUCc 3'
1 - 19
Article - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al.
- Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
CLIP-seq Support 1 for dataset GSM1048187
Method / RBP HITS-CLIP / AGO2
Cell line / Condition Hela / Hela_AGO2_CLIP_control
Location of target site ENST00000368885.3 | 3UTR | CACUGUAACCUCUACCUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23313552 / GSE42701
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PRAD -0.373 0 -0.310 0.01 50 Click to see details
HNSC -0.31 0.02 -0.405 0 42 Click to see details
BRCA 0.197 0.04 0.243 0.01 84 Click to see details
BLCA -0.365 0.07 -0.292 0.12 18 Click to see details
LUSC -0.193 0.12 -0.296 0.04 38 Click to see details
UCEC -0.271 0.13 -0.328 0.09 19 Click to see details
PCPG 0.691 0.26 0.500 0.33 3 Click to see details
KICH -0.136 0.26 -0.022 0.46 25 Click to see details
KIRP 0.106 0.28 0.112 0.27 32 Click to see details
STAD 0.1 0.29 0.157 0.2 32 Click to see details
CESC 0.533 0.32 0.500 0.33 3 Click to see details
PAAD -0.337 0.33 0.000 0.5 4 Click to see details
KIRC 0.05 0.34 0.055 0.33 68 Click to see details
THCA -0.053 0.35 -0.070 0.3 59 Click to see details
ESCA -0.124 0.36 -0.118 0.36 11 Click to see details
COAD 0.056 0.45 0.071 0.43 8 Click to see details
LIHC 0.018 0.45 0.038 0.4 49 Click to see details
CHOL 0.017 0.48 -0.133 0.37 9 Click to see details
LUAD -0.011 0.49 0.203 0.26 12 Click to see details
LUAD -0.011 0.49 0.203 0.26 12 Click to see details
LUAD -0.011 0.49 0.203 0.26 12 Click to see details
581 hsa-let-7e-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT002081 HMGA2 high mobility group AT-hook 2 5 5
MIRT003932 EIF3J eukaryotic translation initiation factor 3 subunit J 2 1
MIRT004469 SMC1A structural maintenance of chromosomes 1A 4 7
MIRT005718 WNT1 Wnt family member 1 4 1
MIRT006122 CCND1 cyclin D1 5 4
MIRT006404 MPL MPL proto-oncogene, thrombopoietin receptor 1 1
MIRT032098 RABGAP1L RAB GTPase activating protein 1 like 1 1
MIRT032099 DAD1 defender against cell death 1 1 1
MIRT032100 MYCN MYCN proto-oncogene, bHLH transcription factor 4 2
MIRT051413 WDR67 TBC1 domain family member 31 1 1
MIRT051414 FAM219B family with sequence similarity 219 member B 1 1
MIRT051415 C11orf91 chromosome 11 open reading frame 91 1 1
MIRT051416 CENPP centromere protein P 1 1
MIRT051417 TMEM107 transmembrane protein 107 1 1
MIRT051418 SREBF1 sterol regulatory element binding transcription factor 1 1 1
MIRT051419 DAAM1 dishevelled associated activator of morphogenesis 1 1 1
MIRT051420 DGCR8 DGCR8, microprocessor complex subunit 1 1
MIRT051421 RAP1A RAP1A, member of RAS oncogene family 1 1
MIRT051422 RPA1 replication protein A1 1 1
MIRT051423 SKIV2L Ski2 like RNA helicase 1 1
MIRT051424 AGO1 argonaute 1, RISC catalytic component 4 2
MIRT051425 RPS27 ribosomal protein S27 1 1
MIRT051426 ARNT2 aryl hydrocarbon receptor nuclear translocator 2 1 1
MIRT051427 GPM6B glycoprotein M6B 1 1
MIRT051428 TTLL12 tubulin tyrosine ligase like 12 1 1
MIRT051429 HIST2H2BF histone cluster 2 H2B family member f 1 1
MIRT051430 CELF2 CUGBP Elav-like family member 2 1 1
MIRT051431 AGO2 argonaute 2, RISC catalytic component 1 1
MIRT051432 VPS13D vacuolar protein sorting 13 homolog D 1 1
MIRT051433 RPL10 ribosomal protein L10 1 1
MIRT051434 SPCS2 signal peptidase complex subunit 2 1 1
MIRT051435 DCAF8 DDB1 and CUL4 associated factor 8 1 1
MIRT051436 CTC1 CST telomere replication complex component 1 1 1
MIRT051437 NAA60 N(alpha)-acetyltransferase 60, NatF catalytic subunit 1 1
MIRT051438 PHF3 PHD finger protein 3 1 1
MIRT051439 TUBA1B tubulin alpha 1b 1 1
MIRT051440 SHANK1 SH3 and multiple ankyrin repeat domains 1 1 1
MIRT051441 SKA2 spindle and kinetochore associated complex subunit 2 1 1
MIRT051442 SPTBN1 spectrin beta, non-erythrocytic 1 1 1
MIRT051443 ND2 MTND2 1 1
MIRT051444 MED13L mediator complex subunit 13 like 1 1
MIRT051445 RCOR3 REST corepressor 3 1 1
MIRT051446 MACF1 microtubule-actin crosslinking factor 1 1 1
MIRT051447 RDX radixin 2 5
MIRT051448 PCBP2 poly(rC) binding protein 2 1 1
MIRT051449 UBAP2L ubiquitin associated protein 2 like 1 1
MIRT051450 CDCA3 cell division cycle associated 3 1 1
MIRT051451 CABLES1 Cdk5 and Abl enzyme substrate 1 1 1
MIRT051452 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 1 1
MIRT051453 C12orf49 chromosome 12 open reading frame 49 1 1
MIRT051454 TIMP3 TIMP metallopeptidase inhibitor 3 1 1
MIRT051455 WBSCR16 RCC1 like 1 1
MIRT051456 SLC2A11 solute carrier family 2 member 11 1 1
MIRT051457 NF1 neurofibromin 1 1 1
MIRT051458 LRRC8A leucine rich repeat containing 8 VRAC subunit A 1 1
MIRT051459 RUNX1T1 RUNX1 translocation partner 1 1 1
MIRT051460 DTNB dystrobrevin beta 1 1
MIRT051461 SCMH1 Scm polycomb group protein homolog 1 1 1
MIRT051462 YWHAG tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma 1 1
MIRT051463 RHBDD2 rhomboid domain containing 2 1 1
MIRT051464 ND5 NADH dehydrogenase, subunit 5 (complex I) 1 1
MIRT051465 NDST1 N-deacetylase and N-sulfotransferase 1 1 1
MIRT051466 IGF2BP3 insulin like growth factor 2 mRNA binding protein 3 2 5
MIRT051467 EIF4A1 eukaryotic translation initiation factor 4A1 1 1
MIRT051468 BAHCC1 BAH domain and coiled-coil containing 1 1 1
MIRT051469 CARM1 coactivator associated arginine methyltransferase 1 1 1
MIRT051470 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 1 1
MIRT051471 ND3 NADH dehydrogenase, subunit 3 (complex I) 1 1
MIRT051472 PIGS phosphatidylinositol glycan anchor biosynthesis class S 1 1
MIRT051473 ALG13 ALG13, UDP-N-acetylglucosaminyltransferase subunit 1 1
MIRT051474 RPN2 ribophorin II 1 1
MIRT051475 RPL12 ribosomal protein L12 1 1
MIRT051476 NME4 NME/NM23 nucleoside diphosphate kinase 4 1 1
MIRT051477 IVD isovaleryl-CoA dehydrogenase 1 1
MIRT051478 JAZF1 JAZF zinc finger 1 1 1
MIRT051479 ND4 NADH dehydrogenase, subunit 4 (complex I) 1 1
MIRT051480 VARS valyl-tRNA synthetase 1 1
MIRT051481 RNF26 ring finger protein 26 1 1
MIRT051482 LHFPL2 LHFPL tetraspan subfamily member 2 1 1
MIRT051483 ARCN1 archain 1 1 1
MIRT051484 COX1 cytochrome c oxidase subunit I 1 1
MIRT051485 SLC12A4 solute carrier family 12 member 4 1 1
MIRT051486 AEBP2 AE binding protein 2 1 1
MIRT051487 PET112 glutamyl-tRNA amidotransferase subunit B 1 1
MIRT051488 UROC1 urocanate hydratase 1 1 1
MIRT051489 IGF1R insulin like growth factor 1 receptor 5 10
MIRT051490 BSDC1 BSD domain containing 1 1 1
MIRT051491 PTK2 protein tyrosine kinase 2 1 1
MIRT051492 CDC5L cell division cycle 5 like 1 1
MIRT051493 EN2 engrailed homeobox 2 1 1
MIRT051494 SSB Sjogren syndrome antigen B 1 1
MIRT051495 SLCO3A1 solute carrier organic anion transporter family member 3A1 1 1
MIRT051496 RRAGC Ras related GTP binding C 1 1
MIRT051497 ZNF236 zinc finger protein 236 1 1
MIRT051498 SEMA4B semaphorin 4B 1 1
MIRT051499 SERBP1 SERPINE1 mRNA binding protein 1 1 1
MIRT051500 XIAP X-linked inhibitor of apoptosis 1 1
MIRT051501 GTF2I general transcription factor IIi 1 1
MIRT051502 JMJD1C jumonji domain containing 1C 1 1
MIRT051503 OTUD5 OTU deubiquitinase 5 1 1
MIRT051504 NOLC1 nucleolar and coiled-body phosphoprotein 1 1 1
MIRT051505 PPIG peptidylprolyl isomerase G 1 1
MIRT051506 PSMD2 proteasome 26S subunit, non-ATPase 2 1 1
MIRT051507 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 1 1
MIRT051508 VAMP2 vesicle associated membrane protein 2 1 1
MIRT051509 LSR lipolysis stimulated lipoprotein receptor 1 1
MIRT051510 KIAA0355 KIAA0355 1 1
MIRT051511 RPSA ribosomal protein SA 1 1
MIRT051512 DCAF6 DDB1 and CUL4 associated factor 6 1 1
MIRT051513 UHRF1BP1 UHRF1 binding protein 1 1 1
MIRT051514 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 1 1
MIRT051515 PIGP phosphatidylinositol glycan anchor biosynthesis class P 1 1
MIRT051516 LMLN leishmanolysin like peptidase 1 1
MIRT051517 PPP2R1A protein phosphatase 2 scaffold subunit Aalpha 1 1
MIRT051518 HIPK1 homeodomain interacting protein kinase 1 1 1
MIRT051519 SERF2 small EDRK-rich factor 2 1 1
MIRT051520 RBM4 RNA binding motif protein 4 1 1
MIRT051521 RBM14 RNA binding motif protein 14 1 1
MIRT051522 HMGB1 high mobility group box 1 1 1
MIRT051523 GMPS guanine monophosphate synthase 1 1
MIRT051524 DIAPH1 diaphanous related formin 1 1 1
MIRT051525 STAM signal transducing adaptor molecule 1 1
MIRT051526 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 1 1
MIRT051527 APPL1 adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 1 1
MIRT051528 MARCH5 membrane associated ring-CH-type finger 5 1 1
MIRT051529 SQLE squalene epoxidase 1 1
MIRT051530 TIMM50 translocase of inner mitochondrial membrane 50 1 1
MIRT051531 NDUFA3 NADH:ubiquinone oxidoreductase subunit A3 1 1
MIRT051532 NDUFS5 NADH:ubiquinone oxidoreductase subunit S5 1 1
MIRT051533 NRSN2 neurensin 2 1 1
MIRT051534 SALL1 spalt like transcription factor 1 1 1
MIRT051535 COX3 cytochrome c oxidase III 1 1
MIRT051536 RABL6 RAB, member RAS oncogene family like 6 1 1
MIRT051537 SUPT4H1 SPT4 homolog, DSIF elongation factor subunit 1 1
MIRT051538 PACS2 phosphofurin acidic cluster sorting protein 2 1 1
MIRT051539 MTMR14 myotubularin related protein 14 1 1
MIRT051540 LUZP1 leucine zipper protein 1 1 1
MIRT051541 PFAS phosphoribosylformylglycinamidine synthase 1 1
MIRT051542 SUZ12 SUZ12 polycomb repressive complex 2 subunit 1 1
MIRT051543 PAPD4 poly(A) RNA polymerase D4, non-canonical 1 1
MIRT051544 QSOX1 quiescin sulfhydryl oxidase 1 1 1
MIRT051545 SPATA13 spermatogenesis associated 13 1 1
MIRT051546 DHX57 DExH-box helicase 57 1 1
MIRT051547 KATNB1 katanin regulatory subunit B1 1 1
MIRT051548 COL6A1 collagen type VI alpha 1 chain 1 1
MIRT051549 DHX15 DEAH-box helicase 15 1 1
MIRT051550 MTCH2 mitochondrial carrier 2 1 1
MIRT051551 KIAA0100 KIAA0100 1 1
MIRT051552 SUGP2 SURP and G-patch domain containing 2 1 1
MIRT051553 NCLN nicalin 1 1
MIRT051554 ATXN2L ataxin 2 like 1 1
MIRT051555 CHD9 chromodomain helicase DNA binding protein 9 1 1
MIRT051556 PES1 pescadillo ribosomal biogenesis factor 1 1 1
MIRT051557 NUP155 nucleoporin 155 2 7
MIRT051558 GNG5 G protein subunit gamma 5 2 3
MIRT051559 ARHGAP19 Rho GTPase activating protein 19 1 1
MIRT051560 MTFR1 mitochondrial fission regulator 1 1 1
MIRT051561 IRS2 insulin receptor substrate 2 2 1
MIRT051562 IRS4 insulin receptor substrate 4 1 1
MIRT051563 PPP1R10 protein phosphatase 1 regulatory subunit 10 1 1
MIRT051564 ZNF284 zinc finger protein 284 1 1
MIRT051565 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 1 1
MIRT051566 SCD stearoyl-CoA desaturase 1 1
MIRT051567 FDPS farnesyl diphosphate synthase 1 1
MIRT051568 KRBOX4 KRAB box domain containing 4 1 1
MIRT051569 BRI3 brain protein I3 1 1
MIRT051570 CHD7 chromodomain helicase DNA binding protein 7 1 1
MIRT051571 PYCR1 pyrroline-5-carboxylate reductase 1 1 1
MIRT051572 SMAP2 small ArfGAP2 1 1
MIRT051573 WDFY3 WD repeat and FYVE domain containing 3 1 1
MIRT051574 CRK CRK proto-oncogene, adaptor protein 1 1
MIRT051575 SRSF2 serine and arginine rich splicing factor 2 1 1
MIRT051576 PGD phosphogluconate dehydrogenase 1 1
MIRT051577 RMND5A required for meiotic nuclear division 5 homolog A 1 1
MIRT051578 ZNF652 zinc finger protein 652 1 1
MIRT051579 PSMA6 proteasome subunit alpha 6 1 1
MIRT051580 SLC38A2 solute carrier family 38 member 2 1 1
MIRT051581 LRRC41 leucine rich repeat containing 41 1 1
MIRT051582 RANBP2 RAN binding protein 2 1 1
MIRT051583 SVIL supervillin 1 1
MIRT051584 CCNG1 cyclin G1 1 1
MIRT051585 ZNF256 zinc finger protein 256 1 1
MIRT051586 COPG1 coatomer protein complex subunit gamma 1 1 1
MIRT051587 PDCD11 programmed cell death 11 1 1
MIRT051588 CNBP CCHC-type zinc finger nucleic acid binding protein 1 1
MIRT051589 USP37 ubiquitin specific peptidase 37 1 1
MIRT051590 UBE2V2 ubiquitin conjugating enzyme E2 V2 1 1
MIRT051591 UBE2H ubiquitin conjugating enzyme E2 H 1 1
MIRT051592 LMNA lamin A/C 1 1
MIRT051593 STAT3 signal transducer and activator of transcription 3 1 1
MIRT051594 TRPV1 transient receptor potential cation channel subfamily V member 1 1 1
MIRT051595 MATR3 matrin 3 1 1
MIRT051596 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 1 1
MIRT051597 HS6ST2 heparan sulfate 6-O-sulfotransferase 2 1 1
MIRT051598 WDR48 WD repeat domain 48 1 1
MIRT051599 RBM8A RNA binding motif protein 8A 1 1
MIRT051600 SCYL1 SCY1 like pseudokinase 1 1 1
MIRT051601 C19orf48 chromosome 19 open reading frame 48 1 1
MIRT051602 FOXD4L6 forkhead box D4 like 6 1 1
MIRT051603 PIGN phosphatidylinositol glycan anchor biosynthesis class N 1 1
MIRT051604 SPCS3 signal peptidase complex subunit 3 1 1
MIRT051605 TNFAIP1 TNF alpha induced protein 1 1 1
MIRT051606 MS4A10 membrane spanning 4-domains A10 1 1
MIRT051607 MSMO1 methylsterol monooxygenase 1 1 1
MIRT051608 ARID1A AT-rich interaction domain 1A 1 1
MIRT051609 NCKIPSD NCK interacting protein with SH3 domain 2 5
MIRT051610 NCBP1 nuclear cap binding protein subunit 1 1 1
MIRT051611 COX16 COX16, cytochrome c oxidase assembly homolog 1 1
MIRT051612 NUDT8 nudix hydrolase 8 1 1
MIRT051613 PHKA1 phosphorylase kinase regulatory subunit alpha 1 1 1
MIRT051614 TXNRD1 thioredoxin reductase 1 1 1
MIRT051615 ELMSAN1 ELM2 and Myb/SANT domain containing 1 1 1
MIRT051616 CTSA cathepsin A 1 1
MIRT051617 PRRC2A proline rich coiled-coil 2A 1 1
MIRT051618 SPAG9 sperm associated antigen 9 1 1
MIRT051619 AGMAT agmatinase 1 1
MIRT051620 NCKAP5L NCK associated protein 5 like 1 1
MIRT051621 ZFP62 ZFP62 zinc finger protein 1 1
MIRT051622 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 1 1
MIRT051623 POLR3D RNA polymerase III subunit D 2 3
MIRT051624 PRPF8 pre-mRNA processing factor 8 1 1
MIRT051625 ATP6 ATP synthase F0 subunit 6 1 1
MIRT051626 ZFAND5 zinc finger AN1-type containing 5 1 1
MIRT051627 BAZ1B bromodomain adjacent to zinc finger domain 1B 1 1
MIRT051628 KATNAL1 katanin catalytic subunit A1 like 1 1 1
MIRT051629 BMP2K BMP2 inducible kinase 1 1
MIRT051630 SPN sialophorin 1 1
MIRT051631 PA2G4 proliferation-associated 2G4 1 1
MIRT051632 RPRD2 regulation of nuclear pre-mRNA domain containing 2 1 1
MIRT051633 TUBB4B tubulin beta 4B class IVb 1 1
MIRT051634 TRRAP transformation/transcription domain associated protein 1 1
MIRT051635 SLCO4A1 solute carrier organic anion transporter family member 4A1 1 1
MIRT051636 CCRN4L nocturnin 1 1
MIRT051637 USE1 unconventional SNARE in the ER 1 1 1
MIRT051638 STARD7 StAR related lipid transfer domain containing 7 1 1
MIRT051639 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 3
MIRT051640 CLTC clathrin heavy chain 1 1
MIRT051641 TERF1 telomeric repeat binding factor 1 1 1
MIRT051642 PAX3 paired box 3 1 1
MIRT051643 CCDC97 coiled-coil domain containing 97 1 1
MIRT051644 HLA-C major histocompatibility complex, class I, C 1 1
MIRT051645 GTPBP8 GTP binding protein 8 (putative) 1 1
MIRT051646 VGLL4 vestigial like family member 4 1 1
MIRT051647 ANKRD40 ankyrin repeat domain 40 1 1
MIRT051648 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 1 1
MIRT051649 ND1 NADH dehydrogenase, subunit 1 (complex I) 1 1
MIRT051650 DSP desmoplakin 1 1
MIRT051651 UBN2 ubinuclein 2 1 1
MIRT051652 ZNF805 zinc finger protein 805 1 1
MIRT051653 RBBP4 RB binding protein 4, chromatin remodeling factor 1 1
MIRT051654 OCLN occludin 1 1
MIRT051655 CBX5 chromobox 5 2 3
MIRT051656 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT051657 MKI67 marker of proliferation Ki-67 1 1
MIRT051658 SUB1 SUB1 homolog, transcriptional regulator 1 1
MIRT051659 RSL1D1 ribosomal L1 domain containing 1 1 1
MIRT051660 SEC23IP SEC23 interacting protein 1 1
MIRT051661 RNMT RNA guanine-7 methyltransferase 1 1
MIRT051662 SGSM3 small G protein signaling modulator 3 1 1
MIRT051663 ZFP3 ZFP3 zinc finger protein 1 1
MIRT051664 GLUL glutamate-ammonia ligase 1 1
MIRT051665 POLD1 DNA polymerase delta 1, catalytic subunit 1 1
MIRT051666 WDR4 WD repeat domain 4 1 1
MIRT051667 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT051668 RAI2 retinoic acid induced 2 1 1
MIRT051669 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 1 1
MIRT051670 UTP15 UTP15, small subunit processome component 1 1
MIRT051671 THADA THADA, armadillo repeat containing 1 1
MIRT051672 ZNF451 zinc finger protein 451 1 1
MIRT051673 CREBBP CREB binding protein 1 1
MIRT051674 ZNF770 zinc finger protein 770 1 1
MIRT051675 CLDN4 claudin 4 1 1
MIRT051676 ZKSCAN7 zinc finger with KRAB and SCAN domains 7 1 1
MIRT051677 NICN1 nicolin 1 1 1
MIRT051678 RPLP2 ribosomal protein lateral stalk subunit P2 1 1
MIRT051679 DCBLD2 discoidin, CUB and LCCL domain containing 2 1 1
MIRT051680 IRGQ immunity related GTPase Q 1 1
MIRT051681 CA5B carbonic anhydrase 5B 1 1
MIRT051682 COX14 COX14, cytochrome c oxidase assembly factor 1 1
MIRT051683 PSD3 pleckstrin and Sec7 domain containing 3 1 1
MIRT051684 RPL27A ribosomal protein L27a 1 1
MIRT051685 CWC15 CWC15 spliceosome associated protein homolog 1 1
MIRT051686 NT5DC2 5'-nucleotidase domain containing 2 1 1
MIRT051687 OR7D2 olfactory receptor family 7 subfamily D member 2 1 1
MIRT051688 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 1 1
MIRT051689 NUDT15 nudix hydrolase 15 1 1
MIRT051690 CDH18 cadherin 18 1 1
MIRT051691 FAM160B1 family with sequence similarity 160 member B1 1 1
MIRT051692 DZIP1 DAZ interacting zinc finger protein 1 1 1
MIRT051693 TDRD7 tudor domain containing 7 1 1
MIRT051694 TCF4 transcription factor 4 1 1
MIRT051695 ENSA endosulfine alpha 1 1
MIRT051696 GTF3C1 general transcription factor IIIC subunit 1 1 1
MIRT051697 TNFRSF1A TNF receptor superfamily member 1A 1 1
MIRT051698 CCDC113 coiled-coil domain containing 113 1 1
MIRT051699 MYO9B myosin IXB 1 1
MIRT051700 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 1 1
MIRT051701 PRAMEF13 PRAME family member 13 1 1
MIRT051702 PMPCA peptidase, mitochondrial processing alpha subunit 2 5
MIRT051703 MRPS2 mitochondrial ribosomal protein S2 1 1
MIRT051704 RACGAP1 Rac GTPase activating protein 1 1 1
MIRT051705 CCDC106 coiled-coil domain containing 106 1 1
MIRT051706 CYP2B6 cytochrome P450 family 2 subfamily B member 6 1 1
MIRT051707 CDKAL1 CDK5 regulatory subunit associated protein 1 like 1 2 3
MIRT051708 PSME4 proteasome activator subunit 4 1 1
MIRT051709 SETD1A SET domain containing 1A 1 1
MIRT054561 MMP9 matrix metallopeptidase 9 3 1
MIRT054579 IGF1 insulin like growth factor 1 3 1
MIRT063195 ADIPOR2 adiponectin receptor 2 2 2
MIRT065687 ESPL1 extra spindle pole bodies like 1, separase 2 4
MIRT067399 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT068154 TXLNA taxilin alpha 2 2
MIRT068528 NHLRC3 NHL repeat containing 3 2 6
MIRT068789 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT073006 ARID3B AT-rich interaction domain 3B 2 6
MIRT076223 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT077616 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT080398 ONECUT2 one cut homeobox 2 2 2
MIRT083300 ZCCHC3 zinc finger CCHC-type containing 3 2 2
MIRT084976 BACH1 BTB domain and CNC homolog 1 2 2
MIRT094160 PCGF3 polycomb group ring finger 3 2 6
MIRT094460 SMARCAD1 SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 2 4
MIRT095766 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT100094 ABT1 activator of basal transcription 1 2 8
MIRT112242 MDM4 MDM4, p53 regulator 2 4
MIRT118586 STK4 serine/threonine kinase 4 2 2
MIRT120921 PDE12 phosphodiesterase 12 2 8
MIRT123317 CALU calumenin 2 2
MIRT152272 TNFSF9 TNF superfamily member 9 2 2
MIRT153847 NCOA3 nuclear receptor coactivator 3 2 2
MIRT168583 HMGA1 high mobility group AT-hook 1 2 4
MIRT180603 CRY2 cryptochrome circadian clock 2 2 2
MIRT187717 SUOX sulfite oxidase 2 2
MIRT191404 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT193101 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT215720 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT218815 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT240330 UBXN2B UBX domain protein 2B 2 2
MIRT243473 TRIM71 tripartite motif containing 71 2 2
MIRT244069 EDN1 endothelin 1 2 2
MIRT252330 SALL3 spalt like transcription factor 3 2 2
MIRT255314 CDV3 CDV3 homolog 2 2
MIRT259277 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT259479 TXLNG taxilin gamma 2 2
MIRT260707 CLDN12 claudin 12 2 6
MIRT264693 C11ORF57 chromosome 11 open reading frame 57 2 4
MIRT266212 PEX11B peroxisomal biogenesis factor 11 beta 2 2
MIRT266626 CHTOP chromatin target of PRMT1 2 2
MIRT268839 C1ORF21 chromosome 1 open reading frame 21 2 2
MIRT294446 ZNF264 zinc finger protein 264 2 2
MIRT297013 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT297443 SLC20A1 solute carrier family 20 member 1 2 4
MIRT300037 BZW1 basic leucine zipper and W2 domains 1 2 4
MIRT300893 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT303320 MXD1 MAX dimerization protein 1 2 2
MIRT309846 NAT8L N-acetyltransferase 8 like 2 2
MIRT322428 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT324731 ACER2 alkaline ceramidase 2 2 2
MIRT402057 ATP6V1F ATPase H+ transporting V1 subunit F 2 4
MIRT437395 LIN28A lin-28 homolog A 4 1
MIRT437396 AURKB aurora kinase B 4 1
MIRT437435 EZH2 enhancer of zeste 2 polycomb repressive complex 2 subunit 2 1
MIRT438632 TNFRSF10B TNF receptor superfamily member 10b 2 1
MIRT439135 MYC MYC proto-oncogene, bHLH transcription factor 0 1
MIRT442020 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT445658 ATP6V1G1 ATPase H+ transporting V1 subunit G1 2 6
MIRT447136 KIF27 kinesin family member 27 2 2
MIRT448259 ZNF774 zinc finger protein 774 2 2
MIRT449005 ANKRD46 ankyrin repeat domain 46 2 2
MIRT449953 FMNL3 formin like 3 2 2
MIRT451155 C19orf53 chromosome 19 open reading frame 53 2 2
MIRT451624 MEIS3P1 Meis homeobox 3 pseudogene 1 2 2
MIRT451693 C1RL complement C1r subcomponent like 2 2
MIRT452092 NUCB2 nucleobindin 2 2 2
MIRT452431 QDPR quinoid dihydropteridine reductase 2 2
MIRT452943 DISC1 disrupted in schizophrenia 1 2 2
MIRT453401 RHD Rh blood group D antigen 2 6
MIRT454164 HIST1H2BK histone cluster 1 H2B family member k 2 2
MIRT454280 FXN frataxin 2 2
MIRT454539 RABL2A RAB, member of RAS oncogene family like 2A 2 2
MIRT454854 ACOT9 acyl-CoA thioesterase 9 2 4
MIRT455676 GLO1 glyoxalase I 2 2
MIRT457248 RABL2B RAB, member of RAS oncogene family like 2B 2 2
MIRT457677 ZNF587 zinc finger protein 587 2 2
MIRT457887 THEM6 thioesterase superfamily member 6 2 4
MIRT458016 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT458279 FUT10 fucosyltransferase 10 2 2
MIRT459736 RRM1 ribonucleotide reductase catalytic subunit M1 2 2
MIRT460453 NOM1 nucleolar protein with MIF4G domain 1 2 4
MIRT460500 FAM105A family with sequence similarity 105 member A 2 6
MIRT460938 NOA1 nitric oxide associated 1 2 4
MIRT461092 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT461169 SLC11A2 solute carrier family 11 member 2 2 4
MIRT461364 COL8A1 collagen type VIII alpha 1 chain 2 2
MIRT462382 YAE1D1 Yae1 domain containing 1 2 2
MIRT462780 ZNF8 zinc finger protein 8 2 2
MIRT463420 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT463662 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT464265 VCL vinculin 2 2
MIRT465122 TSC22D2 TSC22 domain family member 2 2 4
MIRT466184 TMED5 transmembrane p24 trafficking protein 5 2 4
MIRT466722 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT469102 RNF144B ring finger protein 144B 2 2
MIRT469714 RAB40C RAB40C, member RAS oncogene family 2 2
MIRT470425 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT470679 POLR2D RNA polymerase II subunit D 2 4
MIRT470861 PLXND1 plexin D1 2 2
MIRT471271 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT471957 NR6A1 nuclear receptor subfamily 6 group A member 1 2 2
MIRT472672 NAA20 N(alpha)-acetyltransferase 20, NatB catalytic subunit 2 2
MIRT472739 MTUS1 microtubule associated scaffold protein 1 2 6
MIRT473134 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT473234 SMCR7L mitochondrial elongation factor 1 1 4
MIRT473828 MAP2K7 mitogen-activated protein kinase kinase 7 2 2
MIRT473940 LYN LYN proto-oncogene, Src family tyrosine kinase 2 2
MIRT474022 LRRC20 leucine rich repeat containing 20 2 2
MIRT474502 KLHDC8B kelch domain containing 8B 2 2
MIRT474766 KIAA0930 KIAA0930 2 2
MIRT474905 KCTD21 potassium channel tetramerization domain containing 21 2 2
MIRT475331 IFNLR1 interferon lambda receptor 1 2 2
MIRT475379 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT475733 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT476548 GABPB1 GA binding protein transcription factor beta subunit 1 2 4
MIRT476973 FAM83G family with sequence similarity 83 member G 2 4
MIRT477534 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 2 4
MIRT477682 EFHD2 EF-hand domain family member D2 2 2
MIRT481201 ATXN7L3B ataxin 7 like 3B 2 4
MIRT481241 ATXN7L3 ataxin 7 like 3 2 2
MIRT481363 ATG9A autophagy related 9A 2 2
MIRT481388 ATG12 autophagy related 12 2 2
MIRT481652 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT481851 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT482184 AHR aryl hydrocarbon receptor 2 2
MIRT482220 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT485296 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT486659 ZNF28 zinc finger protein 28 2 2
MIRT489413 TUBB2A tubulin beta 2A class IIa 2 2
MIRT491867 ZBTB5 zinc finger and BTB domain containing 5 2 8
MIRT492216 SOCS1 suppressor of cytokine signaling 1 2 2
MIRT492626 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT493323 LIMD2 LIM domain containing 2 2 2
MIRT493901 FAM43A family with sequence similarity 43 member A 2 4
MIRT494263 CEP120 centrosomal protein 120 2 2
MIRT494687 ARID3A AT-rich interaction domain 3A 2 2
MIRT495968 TBC1D19 TBC1 domain family member 19 2 2
MIRT496111 SNX17 sorting nexin 17 2 2
MIRT497875 SLC12A7 solute carrier family 12 member 7 2 2
MIRT498122 PLEKHO1 pleckstrin homology domain containing O1 2 4
MIRT499405 PLCG2 phospholipase C gamma 2 2 4
MIRT499493 GGA3 golgi associated, gamma adaptin ear containing, ARF binding protein 3 2 2
MIRT499653 SDR42E1 short chain dehydrogenase/reductase family 42E, member 1 2 2
MIRT499942 MFSD8 major facilitator superfamily domain containing 8 2 2
MIRT499997 HIST1H2BD histone cluster 1 H2B family member d 2 4
MIRT500819 THBS1 thrombospondin 1 2 3
MIRT500902 STRN striatin 2 4
MIRT501118 SLC5A6 solute carrier family 5 member 6 2 4
MIRT501173 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501202 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT501241 SEMA4C semaphorin 4C 2 6
MIRT501328 RNFT1 ring finger protein, transmembrane 1 2 2
MIRT501355 RNF44 ring finger protein 44 2 4
MIRT501387 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT501441 RAB11FIP4 RAB11 family interacting protein 4 2 2
MIRT501759 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT501943 MBD2 methyl-CpG binding domain protein 2 2 8
MIRT502106 KPNA5 karyopherin subunit alpha 5 2 8
MIRT502130 KMT2D lysine methyltransferase 2D 2 4
MIRT502784 CEP135 centrosomal protein 135 2 2
MIRT502845 CELF1 CUGBP Elav-like family member 1 2 2
MIRT504789 C12orf4 chromosome 12 open reading frame 4 2 2
MIRT505017 ZNF644 zinc finger protein 644 2 2
MIRT506942 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT507252 FIGN fidgetin, microtubule severing factor 2 8
MIRT507694 COIL coilin 2 6
MIRT508401 C1orf210 chromosome 1 open reading frame 210 2 6
MIRT508665 DIABLO diablo IAP-binding mitochondrial protein 2 4
MIRT508932 AK4 adenylate kinase 4 2 4
MIRT510395 ZNF566 zinc finger protein 566 2 6
MIRT510518 YOD1 YOD1 deubiquitinase 2 6
MIRT511386 IKZF3 IKAROS family zinc finger 3 2 4
MIRT512745 CD59 CD59 molecule (CD59 blood group) 2 4
MIRT515954 C9orf156 tRNA methyltransferase O 2 2
MIRT516083 ZBTB8OS zinc finger and BTB domain containing 8 opposite strand 2 4
MIRT523619 FZD9 frizzled class receptor 9 2 4
MIRT523733 FBXW2 F-box and WD repeat domain containing 2 2 4
MIRT523990 DVL3 dishevelled segment polarity protein 3 2 2
MIRT524113 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT525727 SOD2 superoxide dismutase 2 2 2
MIRT527763 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT529727 OPRL1 opioid related nociceptin receptor 1 2 2
MIRT533187 WASL Wiskott-Aldrich syndrome like 2 6
MIRT536378 LEFTY1 left-right determination factor 1 2 2
MIRT543785 RBM12B RNA binding motif protein 12B 2 4
MIRT543868 SLC16A9 solute carrier family 16 member 9 2 2
MIRT545387 PM20D2 peptidase M20 domain containing 2 2 2
MIRT545890 ZNF200 zinc finger protein 200 2 4
MIRT546334 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT547373 MSI2 musashi RNA binding protein 2 2 2
MIRT547579 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT548264 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT548351 EPHA4 EPH receptor A4 2 2
MIRT548534 DUSP1 dual specificity phosphatase 1 2 2
MIRT548560 DNAL1 dynein axonemal light chain 1 2 2
MIRT548779 COLEC12 collectin subfamily member 12 2 2
MIRT548978 CCNT2 cyclin T2 2 2
MIRT549208 BEND4 BEN domain containing 4 2 4
MIRT549763 ZNF611 zinc finger protein 611 2 6
MIRT549799 KIAA0391 KIAA0391 2 2
MIRT549847 ECHDC1 ethylmalonyl-CoA decarboxylase 1 2 2
MIRT550898 ACTA1 actin, alpha 1, skeletal muscle 2 2
MIRT551283 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 6
MIRT551318 GSG2 histone H3 associated protein kinase 2 6
MIRT551932 AKAP8 A-kinase anchoring protein 8 2 4
MIRT552003 RAD18 RAD18, E3 ubiquitin protein ligase 2 2
MIRT552410 ZNF460 zinc finger protein 460 2 4
MIRT553013 USP38 ubiquitin specific peptidase 38 2 2
MIRT555550 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT555711 PDZD8 PDZ domain containing 8 2 2
MIRT557372 HAND1 heart and neural crest derivatives expressed 1 2 2
MIRT557960 FAM222B family with sequence similarity 222 member B 2 2
MIRT559087 C19orf47 chromosome 19 open reading frame 47 2 4
MIRT559497 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT561772 PEG10 paternally expressed 10 2 2
MIRT564402 EMILIN2 elastin microfibril interfacer 2 2 4
MIRT565443 SURF4 surfeit 4 2 2
MIRT566518 PARP16 poly(ADP-ribose) polymerase family member 16 2 2
MIRT567715 E2F6 E2F transcription factor 6 2 2
MIRT568655 ABHD17C abhydrolase domain containing 17C 2 2
MIRT569498 THYN1 thymocyte nuclear protein 1 2 2
MIRT573820 TGOLN2 trans-golgi network protein 2 2 2
MIRT574363 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT574750 GOLGA4 golgin A4 2 2
MIRT574788 FAM104A family with sequence similarity 104 member A 2 2
MIRT576089 Poteg POTE ankyrin domain family, member G 2 2
MIRT576812 Thbs1 thrombospondin 1 2 3
MIRT616370 RWDD1 RWD domain containing 1 2 2
MIRT617851 FMO4 flavin containing monooxygenase 4 2 2
MIRT642394 ZNF556 zinc finger protein 556 2 2
MIRT680519 PRIM2 DNA primase subunit 2 2 2
MIRT680547 ZNF584 zinc finger protein 584 2 2
MIRT680800 ZNF578 zinc finger protein 578 2 2
MIRT680838 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT681141 INTS7 integrator complex subunit 7 2 2
MIRT681271 RFC2 replication factor C subunit 2 2 2
MIRT681323 ZFAND4 zinc finger AN1-type containing 4 2 4
MIRT681359 BRI3BP BRI3 binding protein 2 2
MIRT681506 STAT2 signal transducer and activator of transcription 2 2 2
MIRT681536 ZNF738 zinc finger protein 738 2 2
MIRT681658 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT681738 RAB19 RAB19, member RAS oncogene family 2 4
MIRT681797 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT681869 DNAH9 dynein axonemal heavy chain 9 2 2
MIRT681941 SLC19A3 solute carrier family 19 member 3 2 2
MIRT682102 ITGA3 integrin subunit alpha 3 2 4
MIRT682181 SLC38A7 solute carrier family 38 member 7 2 2
MIRT682238 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT682384 PHACTR4 phosphatase and actin regulator 4 2 2
MIRT682444 MTX3 metaxin 3 2 2
MIRT682604 CPA4 carboxypeptidase A4 2 2
MIRT682640 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT689327 FPR1 formyl peptide receptor 1 2 2
MIRT689730 ATXN2 ataxin 2 2 2
MIRT691036 ZNF799 zinc finger protein 799 2 2
MIRT691935 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT694884 ZNF417 zinc finger protein 417 2 2
MIRT695255 ZNF443 zinc finger protein 443 2 2
MIRT695413 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT700589 PRSS22 protease, serine 22 2 2
MIRT701428 NHLRC2 NHL repeat containing 2 2 2
MIRT702484 KIAA1328 KIAA1328 2 2
MIRT702715 IPO9 importin 9 2 2
MIRT704028 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT704418 CTPS1 CTP synthase 1 2 2
MIRT705750 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT712373 NAP1L1 nucleosome assembly protein 1 like 1 2 2
MIRT713520 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT731263 FASLG Fas ligand 3 1
MIRT732697 Ccr7 chemokine (C-C motif) receptor 7 2 0
MIRT732700 Snhg12 small nucleolar RNA host gene 12 2 0
MIRT734626 SYT7 synaptotagmin 7 1 0
MIRT755829 UBQLN4 ubiquilin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
let-7e Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
let-7e Hydroxamic acid HDACi LAQ824 NULL NULL Microarray breast cancer cell line SKBr3 16452179 2006 down-regulated
let-7e Doxorubicin approved 31703 Microarray ovarian cancer 19237188 2009 up-regulated
let-7e 17beta-estradiol (E2) approved 5757 Microarray MCF-7 breast cancer cells 19528081 2009 up-regulated
let-7e Etoposide approved 36462 Microarray Normal human fibroblasts (AG01522) 19633716 2009 up-regulated
let-7e Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
let-7e 5-Fluorouracil approved 3385 Microarray MCF-7 breast cancer cells 21506117 2011 down-regulated
let-7e Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
let-7e Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
let-7e Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse liver 19270793 2009 down-regulated
let-7e 17beta-estradiol (E2) approved 5757 Microarray rat breast 17700064 2007 down-regulated
let-7e Marine fungal metabolite 1386A NULL NULL Microarray MCF-7 breast cancer cells. 22159329 2012 down-regulated
let-7e Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 down-regulated
let-7e 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 up-regulated
let-7e Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-let-7e Doxorubicin 31703 NSC123127 approved resistant High Ovarian Cancer cell line (OV19, TOV21G, TOV112D, FUOV1, C13, OV2008, A2780CP, A2780S, IGROV1, T8, OVCAR5, IMCC3, A2008, OVCAR3, SKOV3, IOSER)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7e Verapamil 2520 NSC272366 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant High Tongue Squamous Cell Carcinoma cell line (Tca8113)
hsa-let-7e Fluorouracil 3385 NSC19893 approved resistant High Colon Cancer cell line (DLD-1)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer tissue and cell line (A2780)
hsa-let-7e Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-let-7e Paclitaxel 36314 NSC125973 approved sensitive High Pan-Cancer cell line (NCI-H460, NCI-H522, NCI-H322M, HOP62, A549, EKVX, MALME-3M, NCI-H226, HT-29, HCT-116, SE-620, HCT-15, HCC2998, COLO205, HS-578T, NCI/ADR-RES, OVCAR8, OVCAR4, ACHN, SN-12C, 786-O, CAKI-1, UO-31, TK-10, A498, SK-MEL-28, UACC-257, M14, UACC-62, SK
hsa-let-7e Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H1155, H358, H1993)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-let-7e Vincristine 5978 approved sensitive Low Gastric Cancer cell line (SGC7901)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-let-7e Imatinib 5291 NSC743414 approved resistant High Gastrointestinal Stromal Tumor tissue
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-let-7e Doxorubicin 31703 NSC123127 approved sensitive Low Breast Cancer tissue and cell line (MCF-7)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-let-7e Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7e Fluorouracil 3385 NSC19893 approved sensitive High Colorectal Cancer cell line (DLD-1)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (A2780, HO8910, ES2, CAOV3, SKOV3)
hsa-let-7e Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HCT-8)
hsa-let-7e Daunorubicin 30323 NSC82151 approved resistant High Acute Promyelocytic Leukemia cell line (HL60)
hsa-let-7e Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7C)
hsa-let-7e Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7e Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (PC-9)
hsa-let-7e Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375)
hsa-let-7e Gefitinib 123631 NSC715055 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-let-7e Regorafenib 11167602 NSC763932 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-let-7e Ribavirin+Pegylated IFNa-2b resistant tissue (chronic hepatitis C)
hsa-let-7e Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-let-7e 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-let-7e Ethanol+Tamoxifen resistant cell line (LY2)
hsa-let-7e Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-let-7e Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-let-7e Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-let-7e Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-let-7e Gemcitabine 60750 NSC613327 approved resistant cell line (HuH28)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (OE19)
hsa-let-7e Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7e Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-let-7e Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-let-7e Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-let-7e Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-let-7e-5p Alvocidib 5287969 NSC649890 resistant
hsa-let-7e-5p Ethyl, methoxy, prodigisine 135829283 NSC742418 resistant
hsa-let-7e-5p Platinum 23939 resistant Low Ovarian Cancer tissue
hsa-let-7e-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-let-7e-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-let-7e-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-let-7e-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-let-7e-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-let-7e-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-let-7e-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-let-7e-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM17)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-let-7e-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-let-7e-5p Sunitinib 5329102 NSC750690 approved sensitive tissue (clear cell renal cell carcinoma)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-let-7e-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-let-7e-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-let-7e-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)

Error report submission