pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3123 |
Genomic Coordinates | chr1: 241132272 - 241132346 |
Description | Homo sapiens miR-3123 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3123 | ||||||||||||||
Sequence | 49| CAGAGAAUUGUUUAAUC |65 | ||||||||||||||
Evidence | Experimental | ||||||||||||||
Experiments | Illumina | ||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||
SNPs in miRNA |
|
||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | AKNA | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | AT-hook transcription factor | ||||||||||||||||||||
Transcript | NM_030767 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on AKNA | |||||||||||||||||||||
3'UTR of AKNA (miRNA target sites are highlighted) |
>AKNA|NM_030767|3'UTR 1 CTTCACTGGGGGCCCAGAGGCAGATGGGTGGGTGGGTGGGCAGGTGGCCTGCCAGGCCAGGAGTGGGCTGGAGCTGCTGA 81 GGCCCAGAAGGCCCGCATAGTTCCTCACCAGGAGGGTCTCCCTCCAGCACAGGTCCCGCCTGCTCAGTCCCTGTGCTTTC 161 CAAGTGGAGGGGGTGTCAGCTCGGTCACCAAGAGAAGTGACTTCCCAGGAGCACCAGTCCCCTCACAGAGGTGCTGTGAG 241 CGAGGCCTCCTTCGGTCCAGGCAGAACCTCAGGCAGTCTCTCCTGGTCCTGCATGTGTGCAACTCCAGCTAATAATAGGT 321 ATTTTATATACAGATGGACAGATATTTTTTTAAACTGGGGAGTTTTCCTGATCTTGGGTCCTCTTTAGGGGGCCAGACAA 401 GAAAGGCCTACGGTTTCTGGAGCAAACCTGTCCCCCACCTGTGACCAGTCACTCTGGGGCAAGCATCACTGGGAAGGGCA 481 TAGCCGGAGACCTTTCTCCTAGTGACTGGTAGTCAGTGGGGCATTTTAGGATGTCAGGGCCCCAGGGTGACATGTGTCCA 561 GCTTTTCTATGGCAGCAGAGGCCTTTCCCTCAGACAAGCTACAAAGTGCCCAGGATGCCATCCACCATGGTCCCCTTCAG 641 TACCTCACGCATGGTCCCCAGCTTCTCCTAGGATCCCAGTGGCGTTTATCAGTGGCCAGCTACCTGCCAGGCCCGGGCTG 721 GGGCACGGTCTGCGGCCATGAGGCCAGGCCGCCTCCCGCACCCCTACCCCGTGGCAGCAGCATACCTCTGCATTTCTGGA 801 ATGTGTGTGCATCAATGATGTTTGTATATTTGAGGCATTTAAAAATCTATTTTCGTTACGAGGGCAAATGAAGAATGAAT 881 ATTGATCTTAAAAAAAGAAAAGAAGACAAAAAAAATACCCAAAGCCAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | Hela | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1048187. RNA binding protein: AGO2. Condition:Hela_AGO2_CLIP_control
... - Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al., 2013, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Xue Y; Ouyang K; Huang J; Zhou Y; Ouyang H; et al. - Cell, 2013
The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.
LinkOut: [PMID: 23313552]
|
CLIP-seq Support 1 for dataset GSM4903829 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Human neurons / CTLTD_shCTL_a |
Location of target site | NM_030767 | 3UTR | CCGGGUUCAAGUGAUUCUCUUGCCUCAGCCUCCCGAGUAGCUGGGAUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161238 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM4903833 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_a |
Location of target site | NM_030767 | 3UTR | CCUCCCGGGUUCAAGUGAUUCUCUUGCCUCAGCCUCCCGAGUAGCUGGGAUUACAGGCAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM4903835 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / CTL_TD_21_c |
Location of target site | NM_030767 | 3UTR | CAAGUGAUUCUCUUGCCUCAGCCUCCCGAGUAGCUGGGAUUACAGGCAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM4903836 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_a |
Location of target site | NM_030767 | 3UTR | CCCGGGUUCAAGUGAUUCUCUUGCCUCAGCCUCCCGAGUAGCUGGGAUUACAGGCAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM4903837 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_b |
Location of target site | NM_030767 | 3UTR | CAACCUCCGCCUCCCGGGUUCAAGUGAUUCUCUUGCCUCAGCCUCCCGAGUAGCUGGGAUUACAGGCAU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM4903838 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | Dermal fibroblasts / 124_TD_21_c |
Location of target site | NM_030767 | 3UTR | CCCGGGUUCAAGUGAUUCUCUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Accession Series | GSE161239 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM1048187 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | Hela / Hela_AGO2_CLIP_control |
Location of target site | ENST00000307564.4 | 3UTR | UGAUUCUCUUGCCUCAGCCUCCCGAGUAGCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23313552 / GSE42701 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
113 hsa-miR-3123 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT058369 | TBCEL | tubulin folding cofactor E like | ![]() |
![]() |
2 | 4 | ||||||
MIRT059816 | EFNA1 | ephrin A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT066850 | TMEM19 | transmembrane protein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT071503 | CALM1 | calmodulin 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT073758 | NUBP1 | nucleotide binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT074324 | TNRC6A | trinucleotide repeat containing 6A | ![]() |
![]() |
2 | 10 | ||||||
MIRT094805 | LMNB1 | lamin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT099173 | MAP3K4 | mitogen-activated protein kinase kinase kinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT099545 | ID4 | inhibitor of DNA binding 4, HLH protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT122643 | E2F3 | E2F transcription factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT180918 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT192844 | BLOC1S6 | biogenesis of lysosomal organelles complex 1 subunit 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT224984 | BAG4 | BCL2 associated athanogene 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT246065 | NRAS | NRAS proto-oncogene, GTPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT357085 | PRRC1 | proline rich coiled-coil 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT378170 | C5ORF51 | chromosome 5 open reading frame 51 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441636 | KDM5A | lysine demethylase 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT441802 | BCAS1 | breast carcinoma amplified sequence 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443019 | C21orf91 | chromosome 21 open reading frame 91 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443445 | SERPINB4 | serpin family B member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443661 | SERPINB3 | serpin family B member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443776 | STS | steroid sulfatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT444663 | TSPAN14 | tetraspanin 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444924 | KIAA1522 | KIAA1522 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445378 | FOXO1 | forkhead box O1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447920 | PAIP2B | poly(A) binding protein interacting protein 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT449202 | PTPLAD2 | 3-hydroxyacyl-CoA dehydratase 4 | ![]() |
1 | 1 | |||||||
MIRT449713 | TSPYL1 | TSPY like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450403 | TMEM47 | transmembrane protein 47 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450787 | PAPOLG | poly(A) polymerase gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT451381 | C19orf43 | telomerase RNA component interacting RNase | ![]() |
![]() |
2 | 2 | ||||||
MIRT452507 | WDR1 | WD repeat domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453264 | PARP11 | poly(ADP-ribose) polymerase family member 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454642 | FAM83H | family with sequence similarity 83 member H | ![]() |
![]() |
2 | 2 | ||||||
MIRT455513 | C6orf106 | chromosome 6 open reading frame 106 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456709 | LDB1 | LIM domain binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457231 | AP3D1 | adaptor related protein complex 3 delta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT459235 | MRPS21 | mitochondrial ribosomal protein S21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT460553 | IFNAR1 | interferon alpha and beta receptor subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT461424 | CTSL2 | cathepsin V | ![]() |
![]() |
2 | 3 | ||||||
MIRT462869 | CYP51A1 | cytochrome P450 family 51 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467178 | SPTY2D1 | SPT2 chromatin protein domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469233 | RHOBTB3 | Rho related BTB domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474125 | LIPC | lipase C, hepatic type | ![]() |
![]() |
2 | 2 | ||||||
MIRT475509 | HSP90B1 | heat shock protein 90 beta family member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT478134 | DHX36 | DEAH-box helicase 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481326 | ATP5A1 | ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle | ![]() |
![]() |
2 | 2 | ||||||
MIRT482003 | AMOTL2 | angiomotin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482230 | AHCYL2 | adenosylhomocysteinase like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483436 | RHOXF2B | Rhox homeobox family member 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT483824 | ZC3H12B | zinc finger CCCH-type containing 12B | ![]() |
![]() |
2 | 2 | ||||||
MIRT492051 | TNFSF9 | TNF superfamily member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT494114 | DLX6 | distal-less homeobox 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498882 | ZNF12 | zinc finger protein 12 | ![]() |
![]() |
2 | 10 | ||||||
MIRT499674 | NPHP3 | nephrocystin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT506932 | IGDCC4 | immunoglobulin superfamily DCC subclass member 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT509461 | ZNF587 | zinc finger protein 587 | ![]() |
![]() |
2 | 6 | ||||||
MIRT510048 | AKR1B10 | aldo-keto reductase family 1 member B10 | ![]() |
![]() |
2 | 4 | ||||||
MIRT514807 | NWD1 | NACHT and WD repeat domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515217 | CRCP | CGRP receptor component | ![]() |
![]() |
2 | 2 | ||||||
MIRT515486 | INCENP | inner centromere protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT517765 | ZNF366 | zinc finger protein 366 | ![]() |
![]() |
2 | 4 | ||||||
MIRT518216 | TRMT10B | tRNA methyltransferase 10B | ![]() |
![]() |
2 | 2 | ||||||
MIRT519602 | ZNF805 | zinc finger protein 805 | ![]() |
![]() |
2 | 2 | ||||||
MIRT523570 | GGCX | gamma-glutamyl carboxylase | ![]() |
![]() |
2 | 4 | ||||||
MIRT525795 | SOD2 | superoxide dismutase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533055 | ZBTB37 | zinc finger and BTB domain containing 37 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534218 | SLC37A3 | solute carrier family 37 member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT535633 | NR2E1 | nuclear receptor subfamily 2 group E member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535863 | MRPL17 | mitochondrial ribosomal protein L17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536344 | LEFTY1 | left-right determination factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT537923 | DSTYK | dual serine/threonine and tyrosine protein kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT543114 | SKA2 | spindle and kinetochore associated complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544717 | ZNF529 | zinc finger protein 529 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544847 | BASP1 | brain abundant membrane attached signal protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT545536 | ARF3 | ADP ribosylation factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547124 | PHLPP2 | PH domain and leucine rich repeat protein phosphatase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548070 | GIGYF1 | GRB10 interacting GYF protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548446 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT548626 | DAZAP1 | DAZ associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT550259 | FAM120AOS | family with sequence similarity 120A opposite strand | ![]() |
![]() |
2 | 2 | ||||||
MIRT551940 | AKAP8 | A-kinase anchoring protein 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT552511 | ZIK1 | zinc finger protein interacting with K protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT554015 | SPIRE1 | spire type actin nucleation factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556647 | KPNA2 | karyopherin subunit alpha 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT559744 | ACOX1 | acyl-CoA oxidase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560393 | TMEM254 | transmembrane protein 254 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562234 | HMGB2 | high mobility group box 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563325 | ORC4 | origin recognition complex subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563697 | RPS26 | ribosomal protein S26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565066 | USP25 | ubiquitin specific peptidase 25 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565349 | TMED2 | transmembrane p24 trafficking protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565624 | SLC31A1 | solute carrier family 31 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566379 | PNISR | PNN interacting serine and arginine rich protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT567575 | FEM1C | fem-1 homolog C | ![]() |
![]() |
2 | 2 | ||||||
MIRT569383 | DDX20 | DEAD-box helicase 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570037 | FAM228A | family with sequence similarity 228 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT573269 | DCAF10 | DDB1 and CUL4 associated factor 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573912 | PARP1 | poly(ADP-ribose) polymerase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620034 | ST6GALNAC3 | ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635606 | ZWILCH | zwilch kinetochore protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT644413 | FRMD6 | FERM domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652528 | TM9SF4 | transmembrane 9 superfamily member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656238 | MFSD6 | major facilitator superfamily domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661373 | DYRK4 | dual specificity tyrosine phosphorylation regulated kinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662530 | PNPLA4 | patatin like phospholipase domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675551 | MALL | mal, T-cell differentiation protein like | ![]() |
![]() |
2 | 2 | ||||||
MIRT693650 | ACBD7 | acyl-CoA binding domain containing 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696348 | SLC35D2 | solute carrier family 35 member D2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705815 | AKNA | AT-hook transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT707632 | TARDBP | TAR DNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT717902 | COPS8 | COP9 signalosome subunit 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723626 | SOBP | sine oculis binding protein homolog | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|