miRTarBase - #MIRT706220


—
pre-miRNA Information
pre-miRNA hsa-mir-500b   
Genomic Coordinates chrX: 50010672 - 50010750
Description Homo sapiens miR-500b stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-500b-3p
Sequence 51| GCACCCAGGCAAGGAUUCUG |70
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs782140253 8 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ACOT9   
Synonyms ACATE2, CGI-16, MT-ACT48, MTACT48
Description acyl-CoA thioesterase 9
Transcript NM_001033583   
Other Transcripts NM_001037171   
Expression
Putative miRNA Targets on ACOT9
3'UTR of ACOT9
(miRNA target sites are highlighted)		 
>ACOT9|NM_001033583|3'UTR
   1 GAACACCACATTTGTTGAAAACTAGCACTCTACCCACAGTGACGTGGTATCTGATGAAGACCTGATCGAGTGTATTGATT
  81 TTAGTATTGCTTCGTGTCCTCCACACAGGAGGAGGATGTATTCAGCCTTTAGGATGATCAGAAAAGCAGAAAGAGAGAGT
 161 GGCCGGATGGGGCTGAGGGGAGAAAGAATTATTAAACAATAAATACTTTCAAGACAATTTTAATTGTGAACCTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gucUUAGGAACG----GACCCACg 5'
             :||::| |:    ||  ||| 
Target 5' attGATTTTAGTATTGCTTCGTGt 3'
 74 - 97 83.00 -5.90
2 
miRNA  3' gucuuaggaACGGACCCACg 5'
                   || | || || 
Target 5' aagagagagTGGCCGGATGg 3'
 151 - 170 83.00 -9.30
3 
miRNA  3' guCUUAGGAACGGACCCACg 5'
            |||  | || : | ||| 
Target 5' atGAAGACCTGATCGAGTGt 3'
 54 - 73 78.00 -7.60
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1261899109 2 dbSNP
rs777876069 8 dbSNP
rs1319508479 9 dbSNP
rs1239495803 10 dbSNP
rs769926537 10 dbSNP
rs748354251 14 dbSNP
rs1381349492 26 dbSNP
rs781331000 32 dbSNP
rs1304442669 36 dbSNP
rs755193322 38 dbSNP
rs750182350 42 dbSNP
rs1370550387 43 dbSNP
rs1332386564 44 dbSNP
rs994982709 46 dbSNP
rs778599831 47 dbSNP
rs1270976589 54 dbSNP
rs1356036175 57 dbSNP
rs1447837439 58 dbSNP
rs1230824603 61 dbSNP
rs959762778 67 dbSNP
rs897938774 68 dbSNP
rs762780738 87 dbSNP
rs1202176895 89 dbSNP
rs1248312618 92 dbSNP
rs1036459930 93 dbSNP
rs944747965 94 dbSNP
rs890463261 113 dbSNP
rs1050822437 115 dbSNP
rs1452130245 117 dbSNP
rs112520577 123 dbSNP
rs1174885687 136 dbSNP
rs1021766749 148 dbSNP
rs1010412018 152 dbSNP
rs1305167157 160 dbSNP
rs915139783 164 dbSNP
rs989302780 165 dbSNP
rs113264734 169 dbSNP
rs1332071513 185 dbSNP
rs1379182014 186 dbSNP
rs1385355071 191 dbSNP
rs1300848328 200 dbSNP
rs935179010 210 dbSNP
rs891850997 211 dbSNP
rs189980983 217 dbSNP
rs1317184846 220 dbSNP
rs770023790 222 dbSNP
rs923753543 238 dbSNP
rs373915620 250 dbSNP
rs970851800 256 dbSNP
rs1023332354 261 dbSNP
rs990886960 263 dbSNP
rs1190337211 271 dbSNP
rs142239349 275 dbSNP
rs776726490 279 dbSNP
rs1028311157 283 dbSNP
rs748309317 284 dbSNP
rs776573491 285 dbSNP
rs1239660393 286 dbSNP
rs1196203721 287 dbSNP
rs1465609018 291 dbSNP
rs768843183 296 dbSNP
rs1015062739 301 dbSNP
rs760154363 301 dbSNP
rs1293175001 325 dbSNP
rs1368492810 327 dbSNP
rs1008994160 329 dbSNP
rs890529338 330 dbSNP
rs747044948 333 dbSNP
rs1224433562 340 dbSNP
rs1320251054 343 dbSNP
rs185290220 352 dbSNP
rs893778662 353 dbSNP
rs758797456 354 dbSNP
rs1053648203 355 dbSNP
rs935209839 362 dbSNP
rs923782582 364 dbSNP
rs746258463 369 dbSNP
rs949201048 375 dbSNP
rs1477699242 376 dbSNP
rs931867791 379 dbSNP
rs916296127 380 dbSNP
rs920516313 383 dbSNP
rs1164125548 385 dbSNP
rs1350710482 387 dbSNP
rs1459683850 388 dbSNP
rs1296545162 392 dbSNP
rs1391564250 394 dbSNP
rs1293975912 396 dbSNP
rs990532190 410 dbSNP
rs1348099853 414 dbSNP
rs952498592 415 dbSNP
rs1440150973 416 dbSNP
rs940551067 422 dbSNP
rs1026629686 423 dbSNP
rs973655335 424 dbSNP
rs959973308 426 dbSNP
rs1488177879 428 dbSNP
rs1217721414 434 dbSNP
rs1244366405 446 dbSNP
rs1034051703 449 dbSNP
rs979771527 457 dbSNP
rs962255988 493 dbSNP
rs1193380440 502 dbSNP
rs1487779926 508 dbSNP
rs1157144101 510 dbSNP
rs747188790 515 dbSNP
rs1009477634 516 dbSNP
rs890568230 518 dbSNP
rs1029504960 522 dbSNP
rs1021903527 528 dbSNP
rs780157156 532 dbSNP
rs1380789034 533 dbSNP
rs956259121 539 dbSNP
rs893801157 543 dbSNP
rs1241357568 545 dbSNP
rs779365368 545 dbSNP
rs866333166 557 dbSNP
rs1286846210 558 dbSNP
rs868463128 558 dbSNP
rs1238543239 579 dbSNP
rs139470002 579 dbSNP
rs141484914 579 dbSNP
rs556204870 579 dbSNP
rs66555100 579 dbSNP
rs755833842 579 dbSNP
rs763337670 579 dbSNP
rs767066926 579 dbSNP
rs1440496413 581 dbSNP
rs754570146 584 dbSNP
rs1422887368 585 dbSNP
rs1413690090 593 dbSNP
rs1176726348 596 dbSNP
rs1408127704 612 dbSNP
rs751005775 625 dbSNP
rs1376967375 627 dbSNP
rs1331717045 634 dbSNP
rs999431544 646 dbSNP
rs1343382075 648 dbSNP
rs1218946713 651 dbSNP
rs1303466682 661 dbSNP
rs902434459 662 dbSNP
rs758443001 664 dbSNP
rs766375164 688 dbSNP
rs1196852513 691 dbSNP
rs949226846 692 dbSNP
rs916390586 693 dbSNP
rs1385194962 701 dbSNP
rs1245145770 703 dbSNP
rs1477579655 707 dbSNP
rs1049678603 708 dbSNP
rs1365397529 710 dbSNP
rs1431386004 711 dbSNP
rs995487306 718 dbSNP
rs762825775 734 dbSNP
rs1302533599 736 dbSNP
rs1169838026 766 dbSNP
rs1420021031 772 dbSNP
rs746406674 777 dbSNP
rs931039667 780 dbSNP
rs773002431 793 dbSNP
rs919601628 802 dbSNP
rs779346013 808 dbSNP
rs764940598 809 dbSNP
rs1275757254 819 dbSNP
rs1347749764 829 dbSNP
rs761587916 833 dbSNP
rs139361686 841 dbSNP
rs1257966672 843 dbSNP
rs1318716054 846 dbSNP
rs768738998 856 dbSNP
rs940501224 865 dbSNP
rs10156971 866 dbSNP
rs1451205327 870 dbSNP
rs1199825846 875 dbSNP
rs955064034 877 dbSNP
rs1057277542 883 dbSNP
rs938409615 897 dbSNP
rs927031308 900 dbSNP
rs1476110678 904 dbSNP
rs866471588 918 dbSNP
rs1389590073 922 dbSNP
rs200361137 922 dbSNP
rs1405641082 924 dbSNP
rs979740519 927 dbSNP
rs772720583 942 dbSNP
rs1029123607 948 dbSNP
rs1489439600 949 dbSNP
rs996672016 950 dbSNP
rs1261525192 983 dbSNP
rs958105983 985 dbSNP
rs1229734730 987 dbSNP
rs1282549895 994 dbSNP
rs914812636 996 dbSNP
rs192551754 1020 dbSNP
rs1294200088 1022 dbSNP
rs999462723 1030 dbSNP
rs956399618 1031 dbSNP
rs779558666 1040 dbSNP
rs1008816858 1076 dbSNP
rs1046754239 1089 dbSNP
rs1028380468 1101 dbSNP
rs1472836918 1106 dbSNP
rs995456174 1108 dbSNP
rs1013482389 1111 dbSNP
rs1297924212 1112 dbSNP
rs894976015 1129 dbSNP
rs1054933442 1130 dbSNP
rs1332767988 1142 dbSNP
rs1340009466 1145 dbSNP
rs1246728130 1164 dbSNP
rs1317432275 1166 dbSNP
rs751145514 1173 dbSNP
rs1239185832 1174 dbSNP
rs766022487 1176 dbSNP
rs919673386 1178 dbSNP
rs1036722920 1179 dbSNP
rs939653966 1182 dbSNP
rs762097441 1186 dbSNP
rs927000742 1200 dbSNP
rs1296094116 1215 dbSNP
rs1381479921 1224 dbSNP
rs1402467043 1225 dbSNP
rs1174028526 1226 dbSNP
rs757754413 1229 dbSNP
rs762509204 1238 dbSNP
rs1427996083 1243 dbSNP
rs947015151 1245 dbSNP
rs1402034745 1249 dbSNP
rs912207957 1252 dbSNP
rs1338722214 1262 dbSNP
rs1374734440 1264 dbSNP
rs988130222 1284 dbSNP
rs1307970149 1285 dbSNP
rs199945471 1295 dbSNP
rs914278317 1318 dbSNP
rs1230707501 1321 dbSNP
rs1255373844 1322 dbSNP
rs187224716 1327 dbSNP
rs183676865 1328 dbSNP
rs1422154036 1334 dbSNP
rs141585129 1339 dbSNP
rs1178933544 1342 dbSNP
rs2665372 1347 dbSNP
rs375496094 1348 dbSNP
rs1032373694 1351 dbSNP
rs758334208 1352 dbSNP
rs761654356 1353 dbSNP
rs1179170913 1354 dbSNP
rs776551245 1363 dbSNP
rs1398284282 1368 dbSNP
rs1465156031 1373 dbSNP
rs1298973150 1375 dbSNP
rs1258820565 1390 dbSNP
rs1220598196 1394 dbSNP
rs1384885111 1395 dbSNP
rs1319874547 1396 dbSNP
rs1024938793 1400 dbSNP
rs1013930331 1406 dbSNP
rs1226405281 1429 dbSNP
rs912826454 1430 dbSNP
rs895056740 1437 dbSNP
rs750423383 1446 dbSNP
rs191339327 1452 dbSNP
rs147252371 1453 dbSNP
rs898277438 1455 dbSNP
rs1480965066 1456 dbSNP
rs2907514 1461 dbSNP
rs1404662747 1480 dbSNP
rs1331394120 1481 dbSNP
rs1422032940 1484 dbSNP
rs186925804 1485 dbSNP
rs1356333624 1492 dbSNP
rs939711666 1493 dbSNP
rs1167854282 1496 dbSNP
rs1366030250 1513 dbSNP
rs1406486164 1515 dbSNP
rs1473291679 1516 dbSNP
rs1370593382 1517 dbSNP
rs1185628081 1529 dbSNP
rs1444211012 1546 dbSNP
rs890803229 1558 dbSNP
rs1239060794 1559 dbSNP
rs1319367091 1561 dbSNP
rs1243700204 1579 dbSNP
rs1292032810 1580 dbSNP
rs1490619197 1581 dbSNP
rs1318488421 1593 dbSNP
rs1456548393 1609 dbSNP
rs1270730445 1619 dbSNP
rs1195165137 1621 dbSNP
rs1383423375 1622 dbSNP
rs1285761189 1623 dbSNP
rs1242408091 1624 dbSNP
rs1381573791 1625 dbSNP
rs1163196224 1644 dbSNP
rs1290556147 1644 dbSNP
rs1296060217 1644 dbSNP
rs1359634352 1644 dbSNP
rs1386023730 1644 dbSNP
rs1422122699 1644 dbSNP
rs764406046 1644 dbSNP
rs1376411448 1652 dbSNP
rs1394887272 1656 dbSNP
rs1050774413 1658 dbSNP
rs1448273074 1659 dbSNP
rs1237481177 1673 dbSNP
rs933606066 1683 dbSNP
rs1316692869 1684 dbSNP
rs1217208976 1714 dbSNP
rs1328721497 1732 dbSNP
rs1244282811 1736 dbSNP
rs974167460 1738 dbSNP
rs143910851 1749 dbSNP
rs1243998147 1753 dbSNP
rs975343541 1755 dbSNP
rs1446720119 1756 dbSNP
rs1157046817 1761 dbSNP
rs936852929 1762 dbSNP
rs1401060889 1764 dbSNP
rs1015562584 1765 dbSNP
rs925429246 1782 dbSNP
rs775645954 1793 dbSNP
rs1424502383 1796 dbSNP
rs759676971 1802 dbSNP
rs772345781 1802 dbSNP
rs10694335 1803 dbSNP
rs1025431437 1804 dbSNP
rs1444213534 1804 dbSNP
rs747295719 1806 dbSNP
rs1224622395 1815 dbSNP
rs1437836629 1822 dbSNP
rs1203561436 1823 dbSNP
rs1310905051 1823 dbSNP
rs765577481 1823 dbSNP
rs769100179 1823 dbSNP
rs771538347 1823 dbSNP
rs959576579 1823 dbSNP
rs1422776716 1825 dbSNP
rs1189311300 1830 dbSNP
rs1232408591 1831 dbSNP
rs1407736443 1834 dbSNP
rs867764716 1840 dbSNP
rs867260424 1841 dbSNP
rs1354714996 1842 dbSNP
rs200544438 1842 dbSNP
rs995395030 1843 dbSNP
rs898334481 1846 dbSNP
rs1219955542 1847 dbSNP
rs12834700 1848 dbSNP
rs12832761 1849 dbSNP
rs983128432 1853 dbSNP
rs1015401502 1862 dbSNP
rs1003998405 1866 dbSNP
rs777953752 1889 dbSNP
rs1036029707 1896 dbSNP
rs1358477436 1897 dbSNP
rs1002693930 1901 dbSNP
rs1286200546 1906 dbSNP
rs890875772 1911 dbSNP
rs1051224490 1923 dbSNP
rs1370475063 1937 dbSNP
rs1479980770 1939 dbSNP
rs932320540 1950 dbSNP
rs1431269544 1957 dbSNP
rs1044164701 1958 dbSNP
rs1166761223 1973 dbSNP
rs947152438 1978 dbSNP
rs1411341497 1984 dbSNP
rs899464853 1988 dbSNP
rs1436621110 1994 dbSNP
rs1404657980 2006 dbSNP
rs1304286129 2016 dbSNP
rs892883537 2033 dbSNP
rs1333328947 2039 dbSNP
rs1216899093 2050 dbSNP
rs1269716596 2052 dbSNP
rs12863916 2054 dbSNP
rs1340150704 2058 dbSNP
rs951811484 2061 dbSNP
rs1216606750 2063 dbSNP
rs1287921643 2078 dbSNP
rs768364922 2083 dbSNP
rs1222906553 2084 dbSNP
rs1404660289 2096 dbSNP
rs1487297915 2097 dbSNP
rs1039277387 2098 dbSNP
rs934335184 2102 dbSNP
rs1160641789 2103 dbSNP
rs1476099037 2121 dbSNP
rs1418127115 2123 dbSNP
rs1161106574 2138 dbSNP
rs936887545 2141 dbSNP
rs925465146 2142 dbSNP
rs978223814 2143 dbSNP
rs912802943 2145 dbSNP
rs945505361 2147 dbSNP
rs76768453 2150 dbSNP
rs1407597626 2168 dbSNP
rs917990503 2173 dbSNP
rs992597407 2174 dbSNP
rs775651350 2188 dbSNP
rs62585922 2198 dbSNP
rs1479078724 2199 dbSNP
rs1327118138 2203 dbSNP
rs1034073608 2206 dbSNP
rs987485906 2208 dbSNP
rs1313233736 2211 dbSNP
rs973993480 2215 dbSNP
rs1358938351 2224 dbSNP
rs1248325394 2234 dbSNP
rs1197192083 2235 dbSNP
rs1490112951 2237 dbSNP
rs1263657236 2241 dbSNP
rs962611854 2259 dbSNP
rs1293718762 2296 dbSNP
rs144737480 2305 dbSNP
rs1204541422 2307 dbSNP
rs1262267972 2309 dbSNP
rs1004029615 2317 dbSNP
rs974221181 2350 dbSNP
rs1242167584 2355 dbSNP
rs962730729 2365 dbSNP
rs1165082376 2372 dbSNP
rs745891994 2374 dbSNP
rs1452006560 2396 dbSNP
rs757958062 2404 dbSNP
rs1219292413 2412 dbSNP
rs1029426004 2422 dbSNP
rs779395208 2424 dbSNP
rs1346525628 2435 dbSNP
rs899498613 2442 dbSNP
rs1382091325 2445 dbSNP
rs1453734285 2452 dbSNP
rs1317408018 2455 dbSNP
rs13441234 2458 dbSNP
rs1237970397 2464 dbSNP
rs183823075 2484 dbSNP
rs1300415861 2485 dbSNP
rs1201665099 2491 dbSNP
rs1001109593 2504 dbSNP
rs1461368611 2506 dbSNP
rs1185067901 2509 dbSNP
rs1235909177 2509 dbSNP
rs1417737435 2521 dbSNP
rs1364721244 2523 dbSNP
rs904112244 2552 dbSNP
rs982773216 2558 dbSNP
rs1405509172 2564 dbSNP
rs1042557565 2569 dbSNP
rs749744061 2570 dbSNP
rs778244954 2579 dbSNP
rs918050082 2588 dbSNP
rs1062104 2589 dbSNP
rs938059551 2598 dbSNP
rs1035591404 2608 dbSNP
rs1174118069 2610 dbSNP
rs1002828390 2611 dbSNP
rs192495046 2620 dbSNP
rs974065573 2625 dbSNP
rs1282495763 2629 dbSNP
rs1323632868 2630 dbSNP
rs753687786 2637 dbSNP
rs962642171 2645 dbSNP
rs905684779 2651 dbSNP
rs1249285960 2654 dbSNP
rs763730939 2663 dbSNP
rs1195993862 2665 dbSNP
rs982666516 2666 dbSNP
rs955249974 2673 dbSNP
rs560389727 2685 dbSNP
rs1251780076 2709 dbSNP
rs569544328 2721 dbSNP
rs1197903839 2750 dbSNP
rs996620072 2778 dbSNP
rs1484804466 2795 dbSNP
rs1241100595 2799 dbSNP
rs1480820830 2810 dbSNP
rs1210395124 2815 dbSNP
rs1443604064 2817 dbSNP
rs1178615059 2834 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions BCBL-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1015448. RNA binding protein: AGO2. Condition:BCBL-1 mRNA ...

- Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gucUUAGGAACGGACCCACg 5'
             | |||  ||||||||| 
Target 5' ugcACUCC-AGCCUGGGUGa 3'
 		5 - 23
Article - Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al.
- PLoS pathogens, 2012
KSHV is the etiological agent of Kaposi's sarcoma (KS), primary effusion lymphoma (PEL), and a subset of multicentricCastleman's disease (MCD). The fact that KSHV-encoded miRNAs are readily detectable in all KSHV-associated tumors suggests a potential role in viral pathogenesis and tumorigenesis. MiRNA-mediated regulation of gene expression is a complex network with each miRNA having many potential targets, and to date only few KSHV miRNA targets have been experimentally determined. A detailed understanding of KSHV miRNA functions requires high-through putribonomics to globally analyze putative miRNA targets in a cell type-specific manner. We performed Ago HITS-CLIP to identify viral and cellular miRNAs and their cognate targets in two latently KSHV-infected PEL cell lines. Ago HITS-CLIP recovered 1170 and 950 cellular KSHV miRNA targets from BCBL-1 and BC-3, respectively. Importantly, enriched clusters contained KSHV miRNA seed matches in the 3'UTRs of numerous well characterized targets, among them THBS1, BACH1, and C/EBPbeta. KSHV miRNA targets were strongly enriched for genes involved in multiple pathways central for KSHV biology, such as apoptosis, cell cycle regulation, lymphocyte proliferation, and immune evasion, thus further supporting a role in KSHV pathogenesis and potentially tumorigenesis. A limited number of viral transcripts were also enriched by HITS-CLIP including vIL-6 expressed only in a subset of PEL cells during latency. Interestingly, Ago HITS-CLIP revealed extremely high levels of Ago-associated KSHV miRNAs especially in BC-3 cells where more than 70% of all miRNAs are of viral origin. This suggests that in addition to seed match-specific targeting of cellular genes, KSHV miRNAs may also function by hijacking RISCs, thereby contributing to a global de-repression of cellular gene expression due to the loss of regulation by human miRNAs. In summary, we provide an extensive list of cellular and viral miRNA targets representing an important resource to decipher KSHV miRNA function.
LinkOut: [PMID: 22927820]
CLIP-seq Support 1 for dataset GSM1015448
Method / RBP HITS-CLIP / AGO2
Cell line / Condition BCBL-1 / BCBL-1 mRNA
Location of target site ENST00000379303.5 | 3UTR | CCACUGCACUCCAGCCUGGGUGACAGAACGAGACUCCAUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22927820 / GSE41357
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
172 hsa-miR-500b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059905 HDGF heparin binding growth factor 2 4
MIRT235394 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 4
MIRT442246 PYGO1 pygopus family PHD finger 1 2 2
MIRT443591 ZNF439 zinc finger protein 439 2 4
MIRT453280 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT463540 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT465589 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT469462 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT485449 KCTD15 potassium channel tetramerization domain containing 15 2 4
MIRT486682 WDR81 WD repeat domain 81 2 2
MIRT489078 POLM DNA polymerase mu 2 2
MIRT493734 GREM2 gremlin 2, DAN family BMP antagonist 2 2
MIRT494872 DYNLL2 dynein light chain LC8-type 2 2 2
MIRT496130 RNF103-CHMP3 RNF103-CHMP3 readthrough 2 2
MIRT496489 CHMP3 charged multivesicular body protein 3 2 2
MIRT496924 CLMN calmin 2 2
MIRT497297 TMEM119 transmembrane protein 119 2 2
MIRT499103 AGRN agrin 2 2
MIRT508979 CXorf38 chromosome X open reading frame 38 2 2
MIRT509911 NIPAL1 NIPA like domain containing 1 2 2
MIRT512820 ARRDC2 arrestin domain containing 2 2 4
MIRT512827 KBTBD6 kelch repeat and BTB domain containing 6 2 4
MIRT515360 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT516610 TRIM58 tripartite motif containing 58 2 2
MIRT517053 TLDC1 TBC/LysM-associated domain containing 1 2 2
MIRT517637 ZNF491 zinc finger protein 491 2 2
MIRT518270 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT518625 STAR steroidogenic acute regulatory protein 2 2
MIRT518887 N4BP2L2 NEDD4 binding protein 2 like 2 2 2
MIRT519026 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT520365 UBE2G2 ubiquitin conjugating enzyme E2 G2 2 2
MIRT521106 SLC1A5 solute carrier family 1 member 5 2 2
MIRT521943 PHC3 polyhomeotic homolog 3 2 2
MIRT522253 NPEPPS aminopeptidase puromycin sensitive 2 2
MIRT522853 KIAA1551 KIAA1551 2 2
MIRT522868 KIAA1549 KIAA1549 2 2
MIRT524207 DDX19B DEAD-box helicase 19B 2 2
MIRT526004 ARHGAP27 Rho GTPase activating protein 27 2 2
MIRT527769 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT527827 TMEM74B transmembrane protein 74B 2 2
MIRT527861 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT528040 WT1 Wilms tumor 1 2 2
MIRT529802 ZDHHC8 zinc finger DHHC-type containing 8 2 2
MIRT531723 TARS threonyl-tRNA synthetase 2 2
MIRT531996 BARD1 BRCA1 associated RING domain 1 2 2
MIRT533338 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT533621 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT533652 TMOD2 tropomodulin 2 2 2
MIRT534397 SENP3 SUMO1/sentrin/SMT3 specific peptidase 3 2 2
MIRT538686 CCDC80 coiled-coil domain containing 80 2 2
MIRT540444 RBM43 RNA binding motif protein 43 2 2
MIRT542586 ZC3H12C zinc finger CCCH-type containing 12C 2 8
MIRT542796 PLEKHA3 pleckstrin homology domain containing A3 2 4
MIRT542991 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544424 ZNF460 zinc finger protein 460 2 4
MIRT545740 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 4
MIRT552618 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT554456 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT569663 PRIM1 DNA primase subunit 1 2 2
MIRT569924 PCSK9 proprotein convertase subtilisin/kexin type 9 2 2
MIRT570140 IL1RL2 interleukin 1 receptor like 2 2 2
MIRT573558 TMEM120B transmembrane protein 120B 2 2
MIRT574282 OPRD1 opioid receptor delta 1 2 2
MIRT575335 Fbxo6 F-box protein 6 2 2
MIRT607057 IDS iduronate 2-sulfatase 2 2
MIRT607078 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607500 HEBP2 heme binding protein 2 2 2
MIRT607530 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607808 RHBDL2 rhomboid like 2 2 2
MIRT608079 ZFP14 ZFP14 zinc finger protein 2 2
MIRT609119 NUDT3 nudix hydrolase 3 2 2
MIRT609745 PTCH1 patched 1 2 2
MIRT612904 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 2 2
MIRT618720 PCSK2 proprotein convertase subtilisin/kexin type 2 2 2
MIRT618778 HLA-E major histocompatibility complex, class I, E 2 2
MIRT619015 SLC2A6 solute carrier family 2 member 6 2 2
MIRT623223 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT623819 GEMIN6 gem nuclear organelle associated protein 6 2 2
MIRT625704 OPTN optineurin 2 2
MIRT626437 CHDH choline dehydrogenase 2 2
MIRT628087 KAT7 lysine acetyltransferase 7 2 2
MIRT628936 APOB apolipoprotein B 2 2
MIRT633543 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634348 SGOL1 shugoshin 1 2 2
MIRT634611 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635243 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT636681 BTLA B and T lymphocyte associated 2 2
MIRT636923 ZNF845 zinc finger protein 845 2 2
MIRT637606 ZNF554 zinc finger protein 554 2 2
MIRT639242 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT640835 POLR3A RNA polymerase III subunit A 2 2
MIRT642098 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT643087 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643934 C17orf104 meiosis specific with coiled-coil domain 2 2
MIRT644353 FXN frataxin 2 2
MIRT645628 SF3A3 splicing factor 3a subunit 3 2 2
MIRT645754 FAM213A family with sequence similarity 213 member A 2 2
MIRT646329 MVB12B multivesicular body subunit 12B 2 2
MIRT646817 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT647019 ADCY2 adenylate cyclase 2 2 2
MIRT647621 IGSF9B immunoglobulin superfamily member 9B 2 2
MIRT648517 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648871 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649620 ITPKC inositol-trisphosphate 3-kinase C 2 2
MIRT650062 CCDC134 coiled-coil domain containing 134 2 2
MIRT650734 TNFSF8 TNF superfamily member 8 2 2
MIRT652389 TMEM55A phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 2 2
MIRT654352 RBM27 RNA binding motif protein 27 2 2
MIRT655796 NOVA2 NOVA alternative splicing regulator 2 2 2
MIRT657329 HNRNPK heterogeneous nuclear ribonucleoprotein K 2 2
MIRT657734 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT660613 ANO6 anoctamin 6 2 2
MIRT661243 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT662245 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662921 MED18 mediator complex subunit 18 2 2
MIRT662963 JPH2 junctophilin 2 2 2
MIRT663347 ZNF74 zinc finger protein 74 2 2
MIRT663528 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663547 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663977 ZNF786 zinc finger protein 786 2 2
MIRT664084 METTL2B methyltransferase like 2B 2 2
MIRT664358 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664421 TIGD6 tigger transposable element derived 6 2 2
MIRT664476 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664979 TDRD1 tudor domain containing 1 2 2
MIRT665128 PYCRL pyrroline-5-carboxylate reductase 3 2 2
MIRT666259 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666321 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666881 POLQ DNA polymerase theta 2 2
MIRT668469 FADS6 fatty acid desaturase 6 2 2
MIRT669554 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669835 ISCA2 iron-sulfur cluster assembly 2 2 2
MIRT670185 CCDC142 coiled-coil domain containing 142 2 2
MIRT672020 PXMP4 peroxisomal membrane protein 4 2 2
MIRT672070 KIAA0930 KIAA0930 2 2
MIRT672475 RTTN rotatin 2 2
MIRT672851 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT673090 AK1 adenylate kinase 1 2 2
MIRT673581 KDELC2 KDEL motif containing 2 2 2
MIRT674586 SLC35B4 solute carrier family 35 member B4 2 2
MIRT675001 STRN3 striatin 3 2 2
MIRT679018 MTMR10 myotubularin related protein 10 2 2
MIRT679680 STAT3 signal transducer and activator of transcription 3 2 2
MIRT682833 FLG2 filaggrin family member 2 2 2
MIRT682886 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT683442 AP3B2 adaptor related protein complex 3 beta 2 subunit 2 2
MIRT687040 RNF115 ring finger protein 115 2 2
MIRT691957 RHOH ras homolog family member H 2 2
MIRT694625 ZFPM1 zinc finger protein, FOG family member 1 2 2
MIRT695637 SLC26A2 solute carrier family 26 member 2 2 2
MIRT697640 WRN Werner syndrome RecQ like helicase 2 2
MIRT702009 MIDN midnolin 2 2
MIRT702034 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
MIRT704789 CDK6 cyclin dependent kinase 6 2 2
MIRT705728 AMMECR1L AMMECR1 like 2 2
MIRT705879 ADM adrenomedullin 2 2
MIRT706220 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT708418 CERS4 ceramide synthase 4 2 2
MIRT709114 C3orf18 chromosome 3 open reading frame 18 2 2
MIRT709595 ITPA inosine triphosphatase 2 2
MIRT710945 MRPL45 mitochondrial ribosomal protein L45 2 2
MIRT712345 NLN neurolysin 2 2
MIRT712530 CYTH2 cytohesin 2 2 2
MIRT714019 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT717287 ARMC12 armadillo repeat containing 12 2 2
MIRT717733 FGF1 fibroblast growth factor 1 2 2
MIRT718083 CLIC5 chloride intracellular channel 5 2 2
MIRT718562 MUC20 mucin 20, cell surface associated 2 2
MIRT721639 MYLK3 myosin light chain kinase 3 2 2
MIRT722632 C8A complement C8 alpha chain 2 2
MIRT723177 CDCA4 cell division cycle associated 4 2 2
MIRT725523 FAM229B family with sequence similarity 229 member B 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-500b Methotrexate 126941 NSC740 approved resistant cell line (W1)
hsa-miR-500b-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-500b-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-500b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-500b-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-500b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-500b-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)

Error report submission