pre-miRNA Information
pre-miRNA hsa-mir-4708   
Genomic Coordinates chr14: 65335117 - 65335183
Description Homo sapiens miR-4708 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4708-5p
Sequence 9| AGAGAUGCCGCCUUGCUCCUU |29
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1017378847 9 dbSNP
rs750825813 10 dbSNP
rs1297395738 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GJD2   
Synonyms CX36, GJA9
Description gap junction protein delta 2
Transcript NM_020660   
Expression
Putative miRNA Targets on GJD2
3'UTR of GJD2
(miRNA target sites are highlighted)
>GJD2|NM_020660|3'UTR
   1 GAGGGCAGGTTTCATGAAGGTCTGGGGGATGGCAAGG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uuccucgUUCCGCCGU--AGAGa 5'
                 :||  ||||  |:|| 
Target 5' -------GAG--GGCAGGTTTCa 3'
1 - 14 90.00 -8.20
2
miRNA  3' uuCCUCGUUCC--GCCGUAgaga 5'
            ||  :::||  :||||     
Target 5' aaGGTCTGGGGGATGGCAAgg-- 3'
17 - 37 61.00 -11.93
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN17957040 497 COSMIC
COSN8172785 796 COSMIC
COSN21375632 808 COSMIC
COSN15013282 1348 COSMIC
COSN8172784 1383 COSMIC
COSN22788290 1434 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs955978248 9 dbSNP
rs755862258 17 dbSNP
rs780972179 20 dbSNP
rs1265757241 25 dbSNP
rs372564429 27 dbSNP
rs751078368 28 dbSNP
rs766013958 30 dbSNP
rs1038772684 32 dbSNP
rs757724805 33 dbSNP
rs754307386 37 dbSNP
rs373145560 40 dbSNP
rs1338079779 43 dbSNP
rs1403582233 44 dbSNP
rs544517317 47 dbSNP
rs200667131 49 dbSNP
rs577090680 53 dbSNP
rs199863427 54 dbSNP
rs1324330481 62 dbSNP
rs201852436 63 dbSNP
rs908550461 64 dbSNP
rs201005605 65 dbSNP
rs199744979 68 dbSNP
rs201362920 69 dbSNP
rs1484023533 75 dbSNP
rs558322044 78 dbSNP
rs1240084201 79 dbSNP
rs1178043754 80 dbSNP
rs1267639904 91 dbSNP
rs537570012 92 dbSNP
rs113551561 93 dbSNP
rs954228579 94 dbSNP
rs572162872 95 dbSNP
rs553859461 98 dbSNP
rs975638445 101 dbSNP
rs1219047346 103 dbSNP
rs535449404 107 dbSNP
rs1403677877 112 dbSNP
rs926266811 114 dbSNP
rs7173113 123 dbSNP
rs1292322340 125 dbSNP
rs1461479658 144 dbSNP
rs1239332621 145 dbSNP
rs556313509 146 dbSNP
rs1411236107 149 dbSNP
rs1293474755 151 dbSNP
rs755443861 156 dbSNP
rs1391655217 158 dbSNP
rs1002520902 177 dbSNP
rs1009248125 189 dbSNP
rs753978337 191 dbSNP
rs1344039357 205 dbSNP
rs906965774 207 dbSNP
rs1290967312 211 dbSNP
rs1490473088 214 dbSNP
rs960472001 215 dbSNP
rs1258993413 218 dbSNP
rs1426887439 224 dbSNP
rs769046550 225 dbSNP
rs1427603370 232 dbSNP
rs1035247676 233 dbSNP
rs1044089429 258 dbSNP
rs1002082225 262 dbSNP
rs948463052 265 dbSNP
rs905100577 271 dbSNP
rs538516986 272 dbSNP
rs1163265123 281 dbSNP
rs1038254979 289 dbSNP
rs914443851 298 dbSNP
rs1459854999 299 dbSNP
rs1158630294 303 dbSNP
rs1287240280 306 dbSNP
rs181347763 307 dbSNP
rs766551687 308 dbSNP
rs1300082165 309 dbSNP
rs552797456 314 dbSNP
rs1380786399 318 dbSNP
rs1243502243 323 dbSNP
rs924523508 328 dbSNP
rs527889877 331 dbSNP
rs1159868433 357 dbSNP
rs965332366 361 dbSNP
rs934053234 365 dbSNP
rs1258476864 369 dbSNP
rs912560114 373 dbSNP
rs79846152 377 dbSNP
rs1249517055 381 dbSNP
rs1189253032 382 dbSNP
rs548320409 383 dbSNP
rs954092395 386 dbSNP
rs535774405 398 dbSNP
rs978998494 400 dbSNP
rs967622776 401 dbSNP
rs974241817 403 dbSNP
rs1351379245 410 dbSNP
rs763998211 414 dbSNP
rs1015809607 417 dbSNP
rs367739210 422 dbSNP
rs1322562527 424 dbSNP
rs1404221610 425 dbSNP
rs762688013 427 dbSNP
rs1262011549 429 dbSNP
rs1379578952 435 dbSNP
rs1239081232 437 dbSNP
rs1304765669 440 dbSNP
rs1002962188 442 dbSNP
rs906910159 447 dbSNP
rs987790175 449 dbSNP
rs148186107 450 dbSNP
rs1034808993 452 dbSNP
rs1022582299 455 dbSNP
rs1002369340 465 dbSNP
rs139334662 469 dbSNP
rs1484436751 471 dbSNP
rs1297935485 488 dbSNP
rs1398725766 491 dbSNP
rs1420160606 493 dbSNP
rs1387711579 495 dbSNP
rs1289535543 496 dbSNP
rs76912235 497 dbSNP
rs76826781 499 dbSNP
rs1375993644 501 dbSNP
rs1469514585 502 dbSNP
rs1178924571 503 dbSNP
rs1177412502 516 dbSNP
rs1480874009 519 dbSNP
rs1012641600 521 dbSNP
rs1359585059 522 dbSNP
rs1289724027 523 dbSNP
rs1296169310 523 dbSNP
rs1320791099 523 dbSNP
rs1372555314 523 dbSNP
rs1410338479 523 dbSNP
rs1449967060 523 dbSNP
rs1491352704 523 dbSNP
rs572193 523 dbSNP
rs61551629 523 dbSNP
rs1184925007 524 dbSNP
rs1200163311 524 dbSNP
rs1232613578 524 dbSNP
rs1266942754 524 dbSNP
rs1408380037 524 dbSNP
rs142480430 524 dbSNP
rs1427529967 524 dbSNP
rs1480143063 524 dbSNP
rs1483694795 524 dbSNP
rs1491336154 524 dbSNP
rs1491368247 524 dbSNP
rs550654306 524 dbSNP
rs763248914 524 dbSNP
rs878911812 524 dbSNP
rs1212412918 525 dbSNP
rs1491213896 525 dbSNP
rs57925142 525 dbSNP
rs72220671 525 dbSNP
rs776767675 525 dbSNP
rs58041931 526 dbSNP
rs1192618973 532 dbSNP
rs892871664 533 dbSNP
rs1487282408 535 dbSNP
rs1054709842 540 dbSNP
rs1263694518 542 dbSNP
rs60113718 544 dbSNP
rs35271393 547 dbSNP
rs934487010 548 dbSNP
rs1205214265 552 dbSNP
rs1474573945 554 dbSNP
rs780346804 554 dbSNP
rs1186142599 559 dbSNP
rs969207840 562 dbSNP
rs1449866243 563 dbSNP
rs188804234 568 dbSNP
rs1040326420 571 dbSNP
rs1423877335 574 dbSNP
rs944604025 580 dbSNP
rs1351082565 582 dbSNP
rs1428290293 594 dbSNP
rs1269211819 598 dbSNP
rs1365397033 598 dbSNP
rs57475061 600 dbSNP
rs1253714955 603 dbSNP
rs1313318887 604 dbSNP
rs60782015 614 dbSNP
rs912591211 616 dbSNP
rs1359421075 628 dbSNP
rs1210927742 632 dbSNP
rs1292200678 638 dbSNP
rs985445805 640 dbSNP
rs1323751029 652 dbSNP
rs932738407 653 dbSNP
rs920001680 668 dbSNP
rs1190302702 673 dbSNP
rs1217120536 676 dbSNP
rs1328712276 679 dbSNP
rs887050996 683 dbSNP
rs1472448360 699 dbSNP
rs974650912 700 dbSNP
rs1450036172 701 dbSNP
rs1415400371 705 dbSNP
rs1398464262 708 dbSNP
rs1395944151 710 dbSNP
rs1400220452 712 dbSNP
rs1388959195 716 dbSNP
rs1047077867 719 dbSNP
rs1335193710 723 dbSNP
rs998229098 726 dbSNP
rs1470444969 727 dbSNP
rs1286482756 728 dbSNP
rs532433978 732 dbSNP
rs1399775381 733 dbSNP
rs1169717263 734 dbSNP
rs1474267960 735 dbSNP
rs1374585084 736 dbSNP
rs1268802425 738 dbSNP
rs1201971824 739 dbSNP
rs1466461044 739 dbSNP
rs1193867208 740 dbSNP
rs901247463 743 dbSNP
rs1187919994 744 dbSNP
rs1464498653 747 dbSNP
rs1240758454 748 dbSNP
rs564839338 748 dbSNP
rs1204961618 751 dbSNP
rs540000556 753 dbSNP
rs572717578 760 dbSNP
rs981696592 764 dbSNP
rs971601175 767 dbSNP
rs1157798407 768 dbSNP
rs1022612765 790 dbSNP
rs1012507439 796 dbSNP
rs1173797675 804 dbSNP
rs1404828805 805 dbSNP
rs112025264 808 dbSNP
rs1032722289 809 dbSNP
rs373601569 814 dbSNP
rs115484604 815 dbSNP
rs1289107476 817 dbSNP
rs769633108 824 dbSNP
rs867516677 827 dbSNP
rs913525311 828 dbSNP
rs1317283673 833 dbSNP
rs1262763568 847 dbSNP
rs567228311 853 dbSNP
rs1345896496 854 dbSNP
rs1200855641 857 dbSNP
rs1040593119 863 dbSNP
rs1376448176 869 dbSNP
rs944635217 869 dbSNP
rs1251983055 873 dbSNP
rs1329642000 874 dbSNP
rs372712161 876 dbSNP
rs1376750862 877 dbSNP
rs1398410165 879 dbSNP
rs927620334 879 dbSNP
rs980521907 879 dbSNP
rs574873866 881 dbSNP
rs1049777652 884 dbSNP
rs111294921 890 dbSNP
rs920015207 893 dbSNP
rs776192375 895 dbSNP
rs1457362960 899 dbSNP
rs537897759 900 dbSNP
rs1184906034 907 dbSNP
rs1444785489 912 dbSNP
rs1235663764 932 dbSNP
rs1257581776 934 dbSNP
rs1237018009 937 dbSNP
rs200947138 943 dbSNP
rs185998923 962 dbSNP
rs1275269709 963 dbSNP
rs770400387 974 dbSNP
rs746717076 975 dbSNP
rs1433453922 1001 dbSNP
rs971632287 1012 dbSNP
rs1357946144 1026 dbSNP
rs901135676 1027 dbSNP
rs1371757815 1045 dbSNP
rs1449251796 1046 dbSNP
rs607028 1069 dbSNP
rs202007522 1072 dbSNP
rs1247347632 1073 dbSNP
rs1423234457 1080 dbSNP
rs792418 1087 dbSNP
rs1307133162 1089 dbSNP
rs904635507 1091 dbSNP
rs1336525903 1092 dbSNP
rs12439076 1097 dbSNP
rs567090766 1100 dbSNP
rs116316215 1103 dbSNP
rs1344296022 1111 dbSNP
rs1243647708 1113 dbSNP
rs946252557 1114 dbSNP
rs1033082910 1125 dbSNP
rs1211043207 1130 dbSNP
rs1259236748 1132 dbSNP
rs891971295 1133 dbSNP
rs536328847 1136 dbSNP
rs1392388987 1138 dbSNP
rs998639539 1140 dbSNP
rs564785144 1141 dbSNP
rs1379198927 1143 dbSNP
rs967519104 1145 dbSNP
rs568906513 1149 dbSNP
rs550503519 1150 dbSNP
rs938948399 1151 dbSNP
rs1436063473 1154 dbSNP
rs375203610 1159 dbSNP
rs980872463 1160 dbSNP
rs1311934099 1161 dbSNP
rs947810318 1180 dbSNP
rs1246384739 1182 dbSNP
rs1008714323 1187 dbSNP
rs909674186 1188 dbSNP
rs1198607239 1191 dbSNP
rs889041338 1192 dbSNP
rs116083111 1194 dbSNP
rs1250364168 1198 dbSNP
rs1025486108 1206 dbSNP
rs564804757 1210 dbSNP
rs976641921 1238 dbSNP
rs112926421 1239 dbSNP
rs965688864 1240 dbSNP
rs1282268929 1244 dbSNP
rs1411292030 1247 dbSNP
rs1018263645 1250 dbSNP
rs898533509 1259 dbSNP
rs574943942 1265 dbSNP
rs1351674192 1266 dbSNP
rs904597657 1269 dbSNP
rs1021630816 1276 dbSNP
rs11291261 1295 dbSNP
rs1231318879 1303 dbSNP
rs1445543986 1304 dbSNP
rs1038756323 1316 dbSNP
rs1057240136 1321 dbSNP
rs1379830586 1331 dbSNP
rs1397689862 1331 dbSNP
rs938931716 1338 dbSNP
rs940147330 1365 dbSNP
rs906130166 1382 dbSNP
rs546513111 1384 dbSNP
rs1269633598 1389 dbSNP
rs553176133 1398 dbSNP
rs950181694 1400 dbSNP
rs916170997 1402 dbSNP
rs991734726 1404 dbSNP
rs1359767966 1408 dbSNP
rs1315629902 1423 dbSNP
rs1484550536 1427 dbSNP
rs957839460 1428 dbSNP
rs1408070670 1432 dbSNP
rs1171698149 1438 dbSNP
rs779276306 1444 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions BCBL-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1015448. RNA binding protein: AGO2. Condition:BCBL-1 mRNA ...

- Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al., 2012, PLoS pathogens.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' uuccucguuccgccGUAGAGa 5'
                        |||||| 
Target 5' ---------gacucCAUCUCa 3'
1 - 12
Article - Haecker I; Gay LA; Yang Y; Hu J; Morse AM; et al.
- PLoS pathogens, 2012
KSHV is the etiological agent of Kaposi's sarcoma (KS), primary effusion lymphoma (PEL), and a subset of multicentricCastleman's disease (MCD). The fact that KSHV-encoded miRNAs are readily detectable in all KSHV-associated tumors suggests a potential role in viral pathogenesis and tumorigenesis. MiRNA-mediated regulation of gene expression is a complex network with each miRNA having many potential targets, and to date only few KSHV miRNA targets have been experimentally determined. A detailed understanding of KSHV miRNA functions requires high-through putribonomics to globally analyze putative miRNA targets in a cell type-specific manner. We performed Ago HITS-CLIP to identify viral and cellular miRNAs and their cognate targets in two latently KSHV-infected PEL cell lines. Ago HITS-CLIP recovered 1170 and 950 cellular KSHV miRNA targets from BCBL-1 and BC-3, respectively. Importantly, enriched clusters contained KSHV miRNA seed matches in the 3'UTRs of numerous well characterized targets, among them THBS1, BACH1, and C/EBPbeta. KSHV miRNA targets were strongly enriched for genes involved in multiple pathways central for KSHV biology, such as apoptosis, cell cycle regulation, lymphocyte proliferation, and immune evasion, thus further supporting a role in KSHV pathogenesis and potentially tumorigenesis. A limited number of viral transcripts were also enriched by HITS-CLIP including vIL-6 expressed only in a subset of PEL cells during latency. Interestingly, Ago HITS-CLIP revealed extremely high levels of Ago-associated KSHV miRNAs especially in BC-3 cells where more than 70% of all miRNAs are of viral origin. This suggests that in addition to seed match-specific targeting of cellular genes, KSHV miRNAs may also function by hijacking RISCs, thereby contributing to a global de-repression of cellular gene expression due to the loss of regulation by human miRNAs. In summary, we provide an extensive list of cellular and viral miRNA targets representing an important resource to decipher KSHV miRNA function.
LinkOut: [PMID: 22927820]
CLIP-seq Support 1 for dataset GSM1015448
Method / RBP HITS-CLIP / AGO2
Cell line / Condition BCBL-1 / BCBL-1 mRNA
Location of target site ENST00000454994.2 | 3UTR | GACUCCAUCUCAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22927820 / GSE41357
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
94 hsa-miR-4708-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT095681 RBM27 RNA binding motif protein 27 2 4
MIRT104033 USP42 ubiquitin specific peptidase 42 2 6
MIRT114773 CMPK1 cytidine/uridine monophosphate kinase 1 2 2
MIRT246923 CCND1 cyclin D1 2 2
MIRT392569 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT443949 LRIT3 leucine rich repeat, Ig-like and transmembrane domains 3 2 2
MIRT446695 PAPPA pappalysin 1 2 2
MIRT447383 VOPP1 vesicular, overexpressed in cancer, prosurvival protein 1 2 2
MIRT449321 FAM120AOS family with sequence similarity 120A opposite strand 2 2
MIRT449717 C1orf61 chromosome 1 open reading frame 61 2 2
MIRT449738 TAB2 TGF-beta activated kinase 1/MAP3K7 binding protein 2 2 2
MIRT450531 PGLS 6-phosphogluconolactonase 2 2
MIRT455650 YARS tyrosyl-tRNA synthetase 2 2
MIRT458036 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT463468 ZC3HAV1L zinc finger CCCH-type containing, antiviral 1 like 2 2
MIRT466677 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 4
MIRT467789 SLC2A14 solute carrier family 2 member 14 2 2
MIRT468167 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT468652 SECISBP2L SECIS binding protein 2 like 2 6
MIRT469380 RER1 retention in endoplasmic reticulum sorting receptor 1 2 2
MIRT470346 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT472418 NCKAP1 NCK associated protein 1 2 2
MIRT474612 KLF3 Kruppel like factor 3 2 2
MIRT478703 CSRNP2 cysteine and serine rich nuclear protein 2 2 2
MIRT481008 BBC3 BCL2 binding component 3 2 4
MIRT483098 TFPI tissue factor pathway inhibitor 2 2
MIRT485113 SHISA6 shisa family member 6 2 2
MIRT497533 ZNF607 zinc finger protein 607 2 2
MIRT500644 TUBB2A tubulin beta 2A class IIa 2 6
MIRT500890 STRN striatin 2 4
MIRT501900 MED13 mediator complex subunit 13 2 2
MIRT506646 MAPK1 mitogen-activated protein kinase 1 2 4
MIRT512675 ENO4 enolase family member 4 2 2
MIRT516977 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT528754 RPS27 ribosomal protein S27 2 6
MIRT539670 ZBTB44 zinc finger and BTB domain containing 44 2 2
MIRT544129 PPIL1 peptidylprolyl isomerase like 1 2 2
MIRT546382 STOX2 storkhead box 2 2 4
MIRT562143 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT568713 TMEM30B transmembrane protein 30B 2 2
MIRT571029 CENPP centromere protein P 2 2
MIRT572781 ZNF277 zinc finger protein 277 2 2
MIRT573162 SLC30A9 solute carrier family 30 member 9 2 2
MIRT609126 NUDT3 nudix hydrolase 3 2 2
MIRT609284 OAS3 2'-5'-oligoadenylate synthetase 3 2 2
MIRT613430 GALNT6 polypeptide N-acetylgalactosaminyltransferase 6 2 2
MIRT613770 TTC38 tetratricopeptide repeat domain 38 2 2
MIRT616645 LRAT lecithin retinol acyltransferase 2 4
MIRT630892 SLC25A33 solute carrier family 25 member 33 2 2
MIRT636526 FAXC failed axon connections homolog 2 4
MIRT641394 NUBPL nucleotide binding protein like 2 2
MIRT641412 SCN2B sodium voltage-gated channel beta subunit 2 2 2
MIRT642528 CERS4 ceramide synthase 4 2 2
MIRT643186 HYPK huntingtin interacting protein K 2 2
MIRT647800 FRMD8 FERM domain containing 8 2 2
MIRT652150 TRIM71 tripartite motif containing 71 2 2
MIRT652602 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT661606 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT666339 SKAP2 src kinase associated phosphoprotein 2 2 2
MIRT670414 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT671122 ZNF573 zinc finger protein 573 2 2
MIRT671155 ANKRD9 ankyrin repeat domain 9 2 2
MIRT671338 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT671869 ZNF429 zinc finger protein 429 2 2
MIRT671974 IKZF3 IKAROS family zinc finger 3 2 2
MIRT672064 KIAA0930 KIAA0930 2 2
MIRT672654 SLC25A16 solute carrier family 25 member 16 2 4
MIRT672673 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT672771 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT672929 LRRC2 leucine rich repeat containing 2 2 2
MIRT673159 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT673272 RUNDC1 RUN domain containing 1 2 2
MIRT673332 THAP1 THAP domain containing 1 2 2
MIRT673351 SLC35F6 solute carrier family 35 member F6 2 2
MIRT673667 ZNF440 zinc finger protein 440 2 2
MIRT673904 DCTN6 dynactin subunit 6 2 2
MIRT674096 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT674401 MYCBP MYC binding protein 2 2
MIRT674525 PRR23A proline rich 23A 2 2
MIRT674793 NPR1 natriuretic peptide receptor 1 2 2
MIRT674833 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 2 2
MIRT675066 FGD6 FYVE, RhoGEF and PH domain containing 6 2 2
MIRT675080 CCR6 C-C motif chemokine receptor 6 2 2
MIRT675126 FSD2 fibronectin type III and SPRY domain containing 2 2 2
MIRT679401 IL10RB interleukin 10 receptor subunit beta 2 2
MIRT689229 RPS19 ribosomal protein S19 2 2
MIRT694008 PPIL4 peptidylprolyl isomerase like 4 2 2
MIRT699671 SFT2D2 SFT2 domain containing 2 2 2
MIRT706213 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706548 GJD2 gap junction protein delta 2 2 2
MIRT707418 RRP7A ribosomal RNA processing 7 homolog A 2 2
MIRT710648 GLUL glutamate-ammonia ligase 2 2
MIRT719393 NPCA1 Nasopharyngeal carcinoma 1 2 2
MIRT720166 PNPO pyridoxamine 5'-phosphate oxidase 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4708-5p Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4708-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-4708-5p Tripterygium wilfordii Hook F sensitive tissue
hsa-miR-4708-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-4708-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-4708-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission