pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6501 |
Genomic Coordinates | chr21: 33550662 - 33550728 |
Description | Homo sapiens miR-6501 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6501-5p | |||||||||||||||
Sequence | 3| AGUUGCCAGGGCUGCCUUUGGU |24 | |||||||||||||||
Evidence | Experimental | |||||||||||||||
Experiments | Illumina | DRVs in miRNA |
|
|||||||||||||
SNPs in miRNA |
|
|||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | COL13A1 | ||||||||||||||||||||
Synonyms | CMS19, COLXIIIA1 | ||||||||||||||||||||
Description | collagen type XIII alpha 1 chain | ||||||||||||||||||||
Transcript | NM_001130103 | ||||||||||||||||||||
Other Transcripts | NM_080798 , NM_080800 , NM_080801 , NM_080802 , NM_080805 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on COL13A1 | |||||||||||||||||||||
3'UTR of COL13A1 (miRNA target sites are highlighted) |
>COL13A1|NM_001130103|3'UTR 1 TGCCTCTAACCTTGGATTGGCCTGTGTGTGTGTTTGTACATAGAATATTTATTTTTATACAGTTTTCACTTTTTGAAAAT 81 GCCAGAAGTATGATGCATCTTACAGATTATTAAAAAAGAAAGAAAAACCTGCATATTTTGTACAGAAAATATCAACCTCT 161 TCCCTTTTGTTTACAAGATGTTTTGTATAAGCCTATGTCTCTAATACATTTTTTGTTTGGTCGTAATGTCTGCATGATAT 241 TTGTGCACATTTATTAAGTATCGAAGCTTAATAAATTATTGTGTCCTGGTGCCAAAGGGGGCCAGCCAGAACTGAGGTGC 321 TGGCTAGCTCATGTGTGAATTCACATAAATGTAGAGGTCCATGATATTTGCTAAGCTAGGTGTGTCTAAGAGTATTTTAA 401 ACCCTTATGGATTTTCATTATTAAAGGAAATGAAACATGGCAATTCAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 1305.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
CLIP-seq Support 1 for dataset GSM714643 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000398974.3 | 3UTR | CUGCACUCCAGCCUGGGCAACAGAGUGAGACCCUGCCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
167 hsa-miR-6501-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT156859 | FAM126B | family with sequence similarity 126 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT173355 | TP53INP1 | tumor protein p53 inducible nuclear protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT369102 | CHAC1 | ChaC glutathione specific gamma-glutamylcyclotransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442037 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442829 | AZIN1 | antizyme inhibitor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443729 | CCND2 | cyclin D2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453771 | NUCB1 | nucleobindin 1 | ![]() |
![]() |
2 | 10 | ||||||
MIRT453875 | IFRD1 | interferon related developmental regulator 1 | ![]() |
![]() |
2 | 12 | ||||||
MIRT454229 | OSBPL10 | oxysterol binding protein like 10 | ![]() |
![]() |
2 | 11 | ||||||
MIRT458829 | RPUSD2 | RNA pseudouridylate synthase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459898 | PIGO | phosphatidylinositol glycan anchor biosynthesis class O | ![]() |
![]() |
2 | 10 | ||||||
MIRT464162 | VMP1 | vacuole membrane protein 1 | ![]() |
![]() |
2 | 15 | ||||||
MIRT495411 | SMAD2 | SMAD family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496906 | TRIM56 | tripartite motif containing 56 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498653 | AP3B2 | adaptor related protein complex 3 beta 2 subunit | ![]() |
![]() |
2 | 6 | ||||||
MIRT498706 | PGAM5 | PGAM family member 5, mitochondrial serine/threonine protein phosphatase | ![]() |
![]() |
2 | 10 | ||||||
MIRT499308 | ZNF485 | zinc finger protein 485 | ![]() |
![]() |
2 | 6 | ||||||
MIRT499707 | NFATC2IP | nuclear factor of activated T-cells 2 interacting protein | ![]() |
![]() |
2 | 10 | ||||||
MIRT499755 | CIRH1A | UTP4, small subunit processome component | ![]() |
![]() |
2 | 6 | ||||||
MIRT499827 | PCSK9 | proprotein convertase subtilisin/kexin type 9 | ![]() |
![]() |
2 | 8 | ||||||
MIRT503691 | MAVS | mitochondrial antiviral signaling protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT512418 | LAYN | layilin | ![]() |
![]() |
2 | 4 | ||||||
MIRT516232 | RAB3B | RAB3B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT522554 | MCAM | melanoma cell adhesion molecule | ![]() |
![]() |
2 | 4 | ||||||
MIRT523760 | FBXO27 | F-box protein 27 | ![]() |
![]() |
2 | 4 | ||||||
MIRT525107 | PRKD2 | protein kinase D2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT525919 | KIAA0391 | KIAA0391 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527246 | COMMD6 | COMM domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527564 | ADCY7 | adenylate cyclase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528764 | CD1D | CD1d molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT529362 | YWHAB | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT529464 | ZNF546 | zinc finger protein 546 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530676 | CHRNB1 | cholinergic receptor nicotinic beta 1 subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT531635 | C19orf52 | translocase of inner mitochondrial membrane 29 | ![]() |
![]() |
2 | 4 | ||||||
MIRT531909 | SLC4A1 | solute carrier family 4 member 1 (Diego blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT532172 | SEC14L5 | SEC14 like lipid binding 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT534234 | SLC25A16 | solute carrier family 25 member 16 | ![]() |
![]() |
2 | 4 | ||||||
MIRT534561 | RRAGD | Ras related GTP binding D | ![]() |
![]() |
2 | 2 | ||||||
MIRT534971 | PSD3 | pleckstrin and Sec7 domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536738 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT538544 | CELF1 | CUGBP Elav-like family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540462 | ZNF71 | zinc finger protein 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540554 | PPIC | peptidylprolyl isomerase C | ![]() |
![]() |
2 | 2 | ||||||
MIRT543593 | KIAA1549 | KIAA1549 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543963 | RNF20 | ring finger protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544047 | C9orf64 | chromosome 9 open reading frame 64 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544670 | AP1S1 | adaptor related protein complex 1 sigma 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT550665 | TRAF1 | TNF receptor associated factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558540 | CSNK1G3 | casein kinase 1 gamma 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT574917 | Vmp1 | vacuole membrane protein 1 | ![]() |
![]() |
2 | 9 | ||||||
MIRT575298 | Osbpl10 | oxysterol binding protein-like 10 | ![]() |
![]() |
2 | 7 | ||||||
MIRT607960 | SNX22 | sorting nexin 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610649 | TIPRL | TOR signaling pathway regulator | ![]() |
![]() |
2 | 8 | ||||||
MIRT615899 | GATAD1 | GATA zinc finger domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617438 | CCS | copper chaperone for superoxide dismutase | ![]() |
![]() |
2 | 2 | ||||||
MIRT617510 | C5orf45 | MRN complex interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT617548 | MTO1 | mitochondrial tRNA translation optimization 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620565 | WBSCR27 | methyltransferase like 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT623166 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT624161 | DGKE | diacylglycerol kinase epsilon | ![]() |
![]() |
2 | 2 | ||||||
MIRT626090 | MKLN1 | muskelin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627010 | FIG4 | FIG4 phosphoinositide 5-phosphatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT627073 | SF3A1 | splicing factor 3a subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627136 | HS3ST1 | heparan sulfate-glucosamine 3-sulfotransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627340 | TSHZ2 | teashirt zinc finger homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627436 | TAS2R5 | taste 2 receptor member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628273 | CYB5D1 | cytochrome b5 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629091 | F2RL1 | F2R like trypsin receptor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT629282 | UNC13A | unc-13 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT630122 | ARHGEF5 | Rho guanine nucleotide exchange factor 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630247 | SMTNL2 | smoothelin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631260 | CENPM | centromere protein M | ![]() |
![]() |
2 | 2 | ||||||
MIRT631336 | CD300E | CD300e molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT631399 | IL2RA | interleukin 2 receptor subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT632593 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632991 | DUSP18 | dual specificity phosphatase 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633079 | CXorf21 | chromosome X open reading frame 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634223 | TMEM132B | transmembrane protein 132B | ![]() |
![]() |
2 | 2 | ||||||
MIRT635046 | MYH11 | myosin heavy chain 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636444 | LRCH3 | leucine rich repeats and calponin homology domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636649 | CDK4 | cyclin dependent kinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637129 | BAMBI | BMP and activin membrane bound inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT637282 | IBA57 | IBA57 homolog, iron-sulfur cluster assembly | ![]() |
![]() |
2 | 2 | ||||||
MIRT637527 | RGS9BP | regulator of G protein signaling 9 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT637783 | OLA1 | Obg like ATPase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637920 | LILRA2 | leukocyte immunoglobulin like receptor A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638238 | SLC1A5 | solute carrier family 1 member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638444 | PLXDC2 | plexin domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639765 | GPR45 | G protein-coupled receptor 45 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640437 | ERVMER34-1 | endogenous retrovirus group MER34 member 1, envelope | ![]() |
![]() |
2 | 2 | ||||||
MIRT643006 | ZNF829 | zinc finger protein 829 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644233 | SLC35E3 | solute carrier family 35 member E3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644661 | TMCO1 | transmembrane and coiled-coil domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644957 | ATP6AP1L | ATPase H+ transporting accessory protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT645086 | SLC35E2B | solute carrier family 35 member E2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT645256 | DFFA | DNA fragmentation factor subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT645861 | GBP6 | guanylate binding protein family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645987 | ACP6 | acid phosphatase 6, lysophosphatidic | ![]() |
![]() |
2 | 2 | ||||||
MIRT646502 | FAM217B | family with sequence similarity 217 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT646811 | COX19 | COX19, cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT647706 | NFX1 | nuclear transcription factor, X-box binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649657 | TEP1 | telomerase associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650550 | YIPF4 | Yip1 domain family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650785 | GSR | glutathione-disulfide reductase | ![]() |
![]() |
2 | 2 | ||||||
MIRT651461 | XIAP | X-linked inhibitor of apoptosis | ![]() |
![]() |
2 | 2 | ||||||
MIRT652098 | TRUB2 | TruB pseudouridine synthase family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654117 | RPS6KA5 | ribosomal protein S6 kinase A5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658901 | DPY19L4 | dpy-19 like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659370 | CREG2 | cellular repressor of E1A stimulated genes 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662537 | MTAP | methylthioadenosine phosphorylase | ![]() |
![]() |
2 | 2 | ||||||
MIRT662617 | MCM8 | minichromosome maintenance 8 homologous recombination repair factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT663491 | IYD | iodotyrosine deiodinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT663899 | MRI1 | methylthioribose-1-phosphate isomerase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664552 | MKI67IP | nucleolar protein interacting with the FHA domain of MKI67 | ![]() |
1 | 1 | |||||||
MIRT664582 | HSD17B12 | hydroxysteroid 17-beta dehydrogenase 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664953 | PTCD3 | pentatricopeptide repeat domain 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665193 | ESF1 | ESF1 nucleolar pre-rRNA processing protein homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT665446 | WDR17 | WD repeat domain 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665894 | TCEANC2 | transcription elongation factor A N-terminal and central domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666480 | SBNO1 | strawberry notch homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666514 | RNF170 | ring finger protein 170 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666692 | RBM23 | RNA binding motif protein 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666791 | PSMD1 | proteasome 26S subunit, non-ATPase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT667453 | MAPK14 | mitogen-activated protein kinase 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT667553 | LRAT | lecithin retinol acyltransferase | ![]() |
![]() |
2 | 4 | ||||||
MIRT667744 | KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668080 | GMEB1 | glucocorticoid modulatory element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668114 | GK5 | glycerol kinase 5 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT668501 | ESYT2 | extended synaptotagmin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668942 | CNKSR3 | CNKSR family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670408 | ELP2 | elongator acetyltransferase complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671134 | CD226 | CD226 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT671919 | PLEKHS1 | pleckstrin homology domain containing S1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT672287 | GP2 | glycoprotein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672427 | POLR2D | RNA polymerase II subunit D | ![]() |
![]() |
2 | 2 | ||||||
MIRT672762 | UBE2V2 | ubiquitin conjugating enzyme E2 V2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672923 | LRRC2 | leucine rich repeat containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673150 | C1orf50 | chromosome 1 open reading frame 50 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673309 | UBE2G2 | ubiquitin conjugating enzyme E2 G2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673560 | PLA2G16 | phospholipase A2 group XVI | ![]() |
![]() |
2 | 2 | ||||||
MIRT673895 | DCTN6 | dynactin subunit 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674513 | PRR23A | proline rich 23A | ![]() |
![]() |
2 | 2 | ||||||
MIRT674614 | RBBP4 | RB binding protein 4, chromatin remodeling factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT674747 | SLC16A1 | solute carrier family 16 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675693 | PIWIL1 | piwi like RNA-mediated gene silencing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675890 | SNAP29 | synaptosome associated protein 29 | ![]() |
![]() |
2 | 2 | ||||||
MIRT685271 | KIAA1143 | KIAA1143 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686057 | KCNA7 | potassium voltage-gated channel subfamily A member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693886 | C3orf62 | chromosome 3 open reading frame 62 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695594 | TMEM199 | transmembrane protein 199 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696592 | ORMDL2 | ORMDL sphingolipid biosynthesis regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT698041 | TRPM7 | transient receptor potential cation channel subfamily M member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699907 | RUNDC1 | RUN domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706608 | CYB5B | cytochrome b5 type B | ![]() |
![]() |
2 | 2 | ||||||
MIRT706628 | PNPT1 | polyribonucleotide nucleotidyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706640 | NCBP2 | nuclear cap binding protein subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706676 | COL13A1 | collagen type XIII alpha 1 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT706723 | RFK | riboflavin kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT706857 | MAFF | MAF bZIP transcription factor F | ![]() |
![]() |
2 | 2 | ||||||
MIRT706891 | ST3GAL1 | ST3 beta-galactoside alpha-2,3-sialyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706958 | FANCC | Fanconi anemia complementation group C | ![]() |
![]() |
2 | 2 | ||||||
MIRT706976 | XPO5 | exportin 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707010 | RRP36 | ribosomal RNA processing 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707028 | ACTR5 | ARP5 actin related protein 5 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT707068 | MED29 | mediator complex subunit 29 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713253 | ZFP30 | ZFP30 zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT719130 | NR2F6 | nuclear receptor subfamily 2 group F member 6 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|