pre-miRNA Information
pre-miRNA hsa-mir-216a   
Genomic Coordinates chr2: 55988950 - 55989059
Description Homo sapiens miR-216a stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-216a-5p
Sequence 19| UAAUCUCAGCUGGCAACUGUGA |40
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 15 2 - 55989027 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs757094946 2 dbSNP
rs746980700 8 dbSNP
rs1249388997 12 dbSNP
rs1188616124 15 dbSNP
rs1490501989 19 dbSNP
rs1465789697 20 dbSNP
rs370221981 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BA0G4V miR-216a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Tissue .
BA0G4V miR-216a Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma MiRNA qPCR analyses
Gene Information
Gene Symbol DNAJB13   
Synonyms CILD34, RSPH16A, TSARG5, TSARG6
Description DnaJ heat shock protein family (Hsp40) member B13
Transcript NM_153614   
Expression
Putative miRNA Targets on DNAJB13
3'UTR of DNAJB13
(miRNA target sites are highlighted)
>DNAJB13|NM_153614|3'UTR
   1 CTGTGGTGGGCTGGAGCAGGGGTGAGAGGAGGCTAGCCGGGCCTCACCCCACCCCTACCCGCCACAGCCTCAGGGTGTGC
  81 AGGGGAGCCTGCTGCACAGATATGATACAAGGGTGGGATGGCGCAGGGCTTAAACTGACATAATAAAGATCTATTTCCTG
 161 TCCTCCAGCTACA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agUGUC-A-ACGGU----CGACUCUAau 5'
            |||| | || :|    | ||:|||  
Target 5' gcACAGATATGATACAAGGGTGGGATgg 3'
94 - 121 114.00 -12.20
2
miRNA  3' agUGUCAACG-GUCGACUCUaau 5'
            :| |  ||  :| |||||   
Target 5' ggGCTGGAGCAGGGGTGAGAgga 3'
8 - 30 104.00 -10.60
3
miRNA  3' agUGUCAACGG--UCGACUCUAAu 5'
            :|||  ||:  | |||| ||  
Target 5' gcGCAG-GGCTTAAACTGACATAa 3'
121 - 143 89.00 -9.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26973726 5 COSMIC
COSN30179927 15 COSMIC
COSN30193519 30 COSMIC
COSN30493977 34 COSMIC
COSN31492609 38 COSMIC
COSN2534123 44 COSMIC
COSN26973727 44 COSMIC
COSN26973728 47 COSMIC
COSN30502597 48 COSMIC
COSN19711153 52 COSMIC
COSN19621026 58 COSMIC
COSN31611549 74 COSMIC
COSN30457977 105 COSMIC
COSN30492276 124 COSMIC
COSN13349595 152 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs749179145 2 dbSNP
rs745987534 4 dbSNP
rs1329615021 9 dbSNP
rs746548860 13 dbSNP
rs1441818865 15 dbSNP
rs770286328 17 dbSNP
rs770807996 18 dbSNP
rs776710648 21 dbSNP
rs1296154491 23 dbSNP
rs1484508695 23 dbSNP
rs759542073 24 dbSNP
rs1287506869 26 dbSNP
rs765180303 27 dbSNP
rs775401644 28 dbSNP
rs201260938 30 dbSNP
rs767814254 31 dbSNP
rs1215104304 33 dbSNP
rs750563549 34 dbSNP
rs372767380 39 dbSNP
rs766379903 40 dbSNP
rs754413038 42 dbSNP
rs774419352 42 dbSNP
rs755468872 43 dbSNP
rs1413136470 44 dbSNP
rs759543412 45 dbSNP
rs779301355 45 dbSNP
rs368838556 47 dbSNP
rs777491630 48 dbSNP
rs1298871352 49 dbSNP
rs183641677 50 dbSNP
rs770540625 51 dbSNP
rs145215599 52 dbSNP
rs767691654 53 dbSNP
rs370004410 58 dbSNP
rs879213079 58 dbSNP
rs575012074 61 dbSNP
rs1167465343 69 dbSNP
rs540354238 82 dbSNP
rs1210024448 83 dbSNP
rs188177227 86 dbSNP
rs1486640188 87 dbSNP
rs1029813675 89 dbSNP
rs1264963190 93 dbSNP
rs1193936182 96 dbSNP
rs577360881 103 dbSNP
rs546334496 104 dbSNP
rs977140972 113 dbSNP
rs1037383929 115 dbSNP
rs562854405 123 dbSNP
rs1416929750 124 dbSNP
rs956990333 134 dbSNP
rs1342609557 142 dbSNP
rs879574960 154 dbSNP
rs915849669 160 dbSNP
rs948649895 166 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 374407.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' agugucaaCGGUCGACUCUAAu 5'
                  |: |||||||||| 
Target 5' -------aGUGAGCUGAGAUUg 3'
1 - 15
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714643
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000339764.1 | 3UTR | AGUGAGCUGAGAUUGCACCACUGCACUCCAGCCUGGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla -0.836 1.9e-4 -0.779 8.5e-4 13 Click to see details
GSE28544 Breast cancer 0.658 2.4e-4 0.642 3.6e-4 24 Click to see details
GSE32688 Pancreatic cancer -0.289 5.4e-2 -0.227 1.1e-1 32 Click to see details
GSE38226 Liver fibrosis -0.151 2.6e-1 -0.070 3.8e-1 21 Click to see details
GSE21687 Ependynoma primary tumors 0.064 3.1e-1 0.287 1.1e-2 64 Click to see details
GSE17306 Multiple myeloma -0.053 3.6e-1 0.440 7.8e-4 49 Click to see details
GSE27834 Pluripotent stem cells 0.098 3.6e-1 0.059 4.1e-1 16 Click to see details
GSE26953 Aortic valvular endothelial cells -0.035 4.4e-1 -0.036 4.3e-1 24 Click to see details
GSE19350 CNS germ cell tumors 0.007 4.9e-1 0.257 2.1e-1 12 Click to see details
GSE14794 Lymphoblastoid cells -0.001 5.0e-1 0.095 1.9e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.508 0.01 -0.168 0.22 23 Click to see details
LIHC -0.36 0.01 -0.306 0.02 45 Click to see details
KIRP -0.491 0.02 -0.368 0.07 18 Click to see details
PAAD -0.75 0.13 -0.600 0.2 4 Click to see details
CHOL 0.391 0.17 0.286 0.25 8 Click to see details
BRCA -0.158 0.23 0.032 0.44 25 Click to see details
UCEC 0.263 0.23 0.055 0.44 10 Click to see details
PRAD 0.127 0.25 0.188 0.16 31 Click to see details
LUAD 0.245 0.26 0.200 0.3 9 Click to see details
STAD 0.131 0.29 -0.068 0.39 20 Click to see details
KICH -0.186 0.29 -0.018 0.48 11 Click to see details
BLCA 0.165 0.32 0.139 0.35 10 Click to see details
KIRC 0.08 0.34 0.076 0.35 29 Click to see details
ESCA -0.277 0.36 -0.800 0.1 4 Click to see details
THCA 0.04 0.39 -0.036 0.41 47 Click to see details
LUSC -0.06 0.4 -0.122 0.3 20 Click to see details
LUSC -0.06 0.4 -0.122 0.3 20 Click to see details
LUSC -0.06 0.4 -0.122 0.3 20 Click to see details
148 hsa-miR-216a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000534 PTEN phosphatase and tensin homolog 4 3
MIRT005018 SIRT1 sirtuin 1 3 1
MIRT005964 CDC42 cell division cycle 42 2 1
MIRT005969 CD44 CD44 molecule (Indian blood group) 2 1
MIRT007154 SMAD7 SMAD family member 7 1 1
MIRT054887 BECN1 beclin 1 5 3
MIRT067588 METAP2 methionyl aminopeptidase 2 2 6
MIRT099144 MYLIP myosin regulatory light chain interacting protein 2 12
MIRT162313 TGFBR2 transforming growth factor beta receptor 2 2 2
MIRT230668 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT256274 PHAX phosphorylated adaptor for RNA export 2 2
MIRT386817 RAD51L3-RFFL RAD51L3-RFFL readthrough 2 2
MIRT386825 RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase 2 2
MIRT438816 HNF4A hepatocyte nuclear factor 4 alpha 1 1
MIRT464699 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT465962 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466046 TMEM189 transmembrane protein 189 2 2
MIRT466482 TECPR2 tectonin beta-propeller repeat containing 2 2 7
MIRT472209 NGFRAP1 brain expressed X-linked 3 2 4
MIRT472562 NACC1 nucleus accumbens associated 1 2 4
MIRT478921 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT480121 CALR calreticulin 2 2
MIRT497754 OXGR1 oxoglutarate receptor 1 2 2
MIRT497967 TWISTNB TWIST neighbor 2 2
MIRT502882 CDK4 cyclin dependent kinase 4 2 8
MIRT510191 MON1B MON1 homolog B, secretory trafficking associated 2 4
MIRT512407 CD84 CD84 molecule 2 2
MIRT513739 PSD3 pleckstrin and Sec7 domain containing 3 2 4
MIRT526257 DROSHA drosha ribonuclease III 2 2
MIRT528968 FAM19A3 family with sequence similarity 19 member A3, C-C motif chemokine like 2 2
MIRT529599 C6orf132 chromosome 6 open reading frame 132 2 2
MIRT529776 ZNF486 zinc finger protein 486 2 2
MIRT530110 PSAPL1 prosaposin like 1 (gene/pseudogene) 2 2
MIRT530504 FADS6 fatty acid desaturase 6 2 2
MIRT531437 PAK1 p21 (RAC1) activated kinase 1 2 2
MIRT534445 SDR16C5 short chain dehydrogenase/reductase family 16C member 5 2 2
MIRT537286 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT538451 CNNM2 cyclin and CBS domain divalent metal cation transport mediator 2 2 2
MIRT543085 ACTB actin beta 2 2
MIRT550982 ZNF254 zinc finger protein 254 2 2
MIRT556259 MAPRE2 microtubule associated protein RP/EB family member 2 2 2
MIRT556639 LAMC1 laminin subunit gamma 1 2 2
MIRT559127 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT561405 TUBB2A tubulin beta 2A class IIa 2 2
MIRT569677 SEC23B Sec23 homolog B, coat complex II component 2 4
MIRT574660 KLHL15 kelch like family member 15 2 2
MIRT575030 Tecpr2 tectonin beta-propeller repeat containing 2 2 5
MIRT617683 JRKL JRK like 2 2
MIRT618540 SEMA5A semaphorin 5A 2 2
MIRT620805 C1orf27 chromosome 1 open reading frame 27 2 2
MIRT621569 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT622133 SP4 Sp4 transcription factor 2 2
MIRT624913 CTCFL CCCTC-binding factor like 2 2
MIRT625010 PAK4 p21 (RAC1) activated kinase 4 2 2
MIRT626644 ZNF551 zinc finger protein 551 2 2
MIRT626646 ATP5A1 ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle 2 2
MIRT626672 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT627945 NNT nicotinamide nucleotide transhydrogenase 2 2
MIRT627963 NLK nemo like kinase 2 2
MIRT628767 SRSF7 serine and arginine rich splicing factor 7 2 2
MIRT629261 KDM2B lysine demethylase 2B 2 2
MIRT629422 ADM2 adrenomedullin 2 2 2
MIRT630238 SORD sorbitol dehydrogenase 2 2
MIRT631272 CENPM centromere protein M 2 4
MIRT631793 CLK4 CDC like kinase 4 2 2
MIRT632058 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT632485 RPS15A ribosomal protein S15a 2 2
MIRT632611 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT632708 MTA3 metastasis associated 1 family member 3 2 2
MIRT632815 INO80 INO80 complex subunit 2 2
MIRT635956 PLA2G12A phospholipase A2 group XIIA 2 2
MIRT636152 UBXN2A UBX domain protein 2A 2 2
MIRT636899 C5orf45 MRN complex interacting protein 2 4
MIRT636930 AGAP9 ArfGAP with GTPase domain, ankyrin repeat and PH domain 9 2 2
MIRT637457 ZNF324B zinc finger protein 324B 2 2
MIRT637900 SLC19A3 solute carrier family 19 member 3 2 2
MIRT639826 ZNF638 zinc finger protein 638 2 2
MIRT640445 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT640681 ARSK arylsulfatase family member K 2 2
MIRT641611 CAPN7 calpain 7 2 2
MIRT641676 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT646786 IL23R interleukin 23 receptor 2 2
MIRT648352 A2ML1 alpha-2-macroglobulin like 1 2 2
MIRT649144 SPATA5 spermatogenesis associated 5 2 2
MIRT649254 TRIM65 tripartite motif containing 65 2 2
MIRT652491 TMEM178B transmembrane protein 178B 2 2
MIRT653308 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT653945 SEPSECS Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase 2 2
MIRT654212 RNF19B ring finger protein 19B 2 2
MIRT654839 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT655159 PHF21A PHD finger protein 21A 2 2
MIRT655316 PDCD11 programmed cell death 11 2 2
MIRT655375 PAX3 paired box 3 2 2
MIRT657301 HOXB5 homeobox B5 2 2
MIRT657593 GRIN2A glutamate ionotropic receptor NMDA type subunit 2A 2 2
MIRT658460 FAM117B family with sequence similarity 117 member B 2 2
MIRT658716 ELOVL4 ELOVL fatty acid elongase 4 2 2
MIRT661640 UGT2B28 UDP glucuronosyltransferase family 2 member B28 2 2
MIRT661712 MTO1 mitochondrial tRNA translation optimization 1 2 4
MIRT661833 ZNF793 zinc finger protein 793 2 2
MIRT663805 BET1L Bet1 golgi vesicular membrane trafficking protein like 2 2
MIRT663884 CXorf56 chromosome X open reading frame 56 2 2
MIRT664672 L2HGDH L-2-hydroxyglutarate dehydrogenase 2 2
MIRT665814 TMEM168 transmembrane protein 168 2 2
MIRT668159 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT668430 FAM20B FAM20B, glycosaminoglycan xylosylkinase 2 2
MIRT672306 GP2 glycoprotein 2 2 2
MIRT673101 SYNPO2L synaptopodin 2 like 2 2
MIRT673437 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT673584 KDELC2 KDEL motif containing 2 2 2
MIRT673718 SLU7 SLU7 homolog, splicing factor 2 2
MIRT673777 MRPL17 mitochondrial ribosomal protein L17 2 2
MIRT674316 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT674820 FAM229B family with sequence similarity 229 member B 2 2
MIRT675179 BPTF bromodomain PHD finger transcription factor 2 2
MIRT675586 WWC1 WW and C2 domain containing 1 2 2
MIRT675812 MED28 mediator complex subunit 28 2 2
MIRT677632 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 2
MIRT683914 PSMB9 proteasome subunit beta 9 2 2
MIRT687135 QPCTL glutaminyl-peptide cyclotransferase like 2 2
MIRT691973 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 2 2
MIRT693078 AS3MT arsenite methyltransferase 2 2
MIRT694084 RNASEH2B ribonuclease H2 subunit B 2 2
MIRT696292 IER3IP1 immediate early response 3 interacting protein 1 2 2
MIRT696541 C3 complement C3 2 2
MIRT701955 MITF melanogenesis associated transcription factor 2 2
MIRT703276 GNG12 G protein subunit gamma 12 2 2
MIRT706852 DNAJB13 DnaJ heat shock protein family (Hsp40) member B13 2 2
MIRT706993 XPO5 exportin 5 2 2
MIRT710716 KRTAP6-1 keratin associated protein 6-1 2 2
MIRT711305 ACOX1 acyl-CoA oxidase 1 2 2
MIRT711514 ESCO1 establishment of sister chromatid cohesion N-acetyltransferase 1 2 2
MIRT711648 LIPG lipase G, endothelial type 2 2
MIRT711772 CCDC59 coiled-coil domain containing 59 2 2
MIRT714280 COQ7 coenzyme Q7, hydroxylase 2 2
MIRT715048 PRPF38A pre-mRNA processing factor 38A 2 2
MIRT716934 INCENP inner centromere protein 2 2
MIRT717220 OTUD3 OTU deubiquitinase 3 2 2
MIRT717865 BICD2 BICD cargo adaptor 2 2 2
MIRT718836 SNX20 sorting nexin 20 2 2
MIRT720243 GPBP1 GC-rich promoter binding protein 1 2 2
MIRT721969 MCM8 minichromosome maintenance 8 homologous recombination repair factor 2 2
MIRT724000 LMTK2 lemur tyrosine kinase 2 2 2
MIRT725193 SDAD1 SDA1 domain containing 1 2 2
MIRT731669 CBL Cbl proto-oncogene 3 1
MIRT732776 AQP4 aquaporin 4 3 0
MIRT733158 ITGA5 integrin subunit alpha 5 1 0
MIRT735623 TLR4 toll like receptor 4 4 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-216a Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-216a Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-216a-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3, 2008, OVCAR10, OVCAR3, HeLa, MCF7, MDA-MB-468)
hsa-miR-216a-5p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-216a-5p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-216a-5p Doxorubicin 31703 NSC123127 approved sensitive High Small Cell Lung Cancer cell line (NCI-H69)
hsa-miR-216a-5p Sorafenib 216239 NSC747971 approved resistant Low Hepatocellular Carcinoma tissue and cell line (HepG2, Hep3B, Huh-7, PLC/PRF/5, HCCLM3, Bel-7404, HLE, SK-HEP-1, SNU-449)
hsa-miR-216a-5p Fluorouracil 3385 NSC19893 approved resistant High Colorectal Cancer tissue
hsa-miR-216a-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer tissue
hsa-miR-216a-5p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (Huh-7)
hsa-miR-216a-5p Doxorubicin 31703 NSC123127 approved resistant Low Small Cell Lung Cancer cell line (H69, H446)
hsa-miR-216a-5p Cisplatin 5460033 NSC119875 approved resistant Low Ovarian Cancer cell line (SKOV3, OVCA433)
hsa-miR-216a-5p Oxaliplatin 6857599 NSC266046 approved resistant Low Gastric Cancer cell line (MGC, SGC)
hsa-miR-216a-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-216a-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-216a-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-216a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-216a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM11)
hsa-miR-216a-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-216a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-216a-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-216a-5p Exemestane 60198 NSC713563 approved sensitive cell line (MCF-7)
hsa-miR-216a-5p Testosterone+Tamoxifen sensitive cell line (MCF-7)
hsa-miR-216a-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-216a-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR8)
hsa-miR-216a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission