miRTarBase - #MIRT707052


—
pre-miRNA Information
pre-miRNA hsa-mir-1245a   
Genomic Coordinates chr2: 188978092 - 188978161
Description Homo sapiens miR-1245a stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1245a
Sequence 45| AAGUGAUCUAAAGGCCUACAU |65
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31562560 15 COSMIC
COSN26581044 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs906938680 2 dbSNP
rs1159117523 3 dbSNP
rs780486044 6 dbSNP
rs771479866 17 dbSNP
rs1002976932 18 dbSNP
rs1428029219 19 dbSNP
Putative Targets

Gene Information
Gene Symbol TRPV2   
Synonyms VRL, VRL-1, VRL1
Description transient receptor potential cation channel subfamily V member 2
Transcript NM_016113   
Expression
Putative miRNA Targets on TRPV2
3'UTR of TRPV2
(miRNA target sites are highlighted)		 
>TRPV2|NM_016113|3'UTR
   1 TGGCCCAGATGCAGCAGGAGGCCAGAGGACAGAGCAGAGGATCTTTCCAACCACATCTGCTGGCTCTGGGGTCCCAGTGA
  81 ATTCTGGTGGCAAATATATATTTTCACTAACTAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uacauCCGGAAAUCUAGUGaa 5'
               |||: | :|:|| |  
Target 5' ctgctGGCTCTGGGGTCCCag 3'
 57 - 77 88.00 -10.20
2 
miRNA  3' uacauCCGGAAAUCUA-GUgaa 5'
               ||||   |||| ||   
Target 5' ----tGGCC--CAGATGCAgca 3'
 1 - 16 80.00 -6.52
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30539631 23 COSMIC
COSN28726597 91 COSMIC
COSN6653232 114 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1238784831 4 dbSNP
rs529500225 11 dbSNP
rs767154927 13 dbSNP
rs752453301 14 dbSNP
rs755555835 17 dbSNP
rs1483647419 18 dbSNP
rs1459992564 22 dbSNP
rs777379985 22 dbSNP
rs750854811 29 dbSNP
rs1418651615 35 dbSNP
rs1158161494 36 dbSNP
rs1412509166 38 dbSNP
rs542808221 39 dbSNP
rs909632553 40 dbSNP
rs937114354 51 dbSNP
rs1358459694 52 dbSNP
rs1240964687 64 dbSNP
rs376388597 65 dbSNP
rs1037978797 68 dbSNP
rs1205803618 71 dbSNP
rs1438769987 72 dbSNP
rs1275669660 84 dbSNP
rs1055450489 96 dbSNP
rs895373032 106 dbSNP
rs1292568306 107 dbSNP
rs1248347642 108 dbSNP
rs7214366 114 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 51393.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714643. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714643
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000338560.7 | 3UTR | GAAAUCACUAAUAGGAAGUGCCGUCAGAAGCGAUAACUGACGAAGACUACUCCUGUCUGAUUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
UCEC 0.931 0.12 1.000 0.5 3 Click to see details
BRCA -0.869 0.16 -0.500 0.33 3 Click to see details
BLCA -0.8 0.2 -0.500 0.33 3 Click to see details
HNSC 0.069 0.44 0.536 0.11 7 Click to see details
HNSC 0.069 0.44 0.536 0.11 7 Click to see details
HNSC 0.069 0.44 0.536 0.11 7 Click to see details
HNSC 0.069 0.44 0.536 0.11 7 Click to see details
HNSC 0.069 0.44 0.536 0.11 7 Click to see details
109 hsa-miR-1245a Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006574 BRCA2 BRCA2, DNA repair associated 2 1
MIRT055432 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT063879 RASSF8 Ras association domain family member 8 2 6
MIRT077025 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT095775 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT099172 MAP3K4 mitogen-activated protein kinase kinase kinase 4 2 2
MIRT175616 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT456518 LYPLAL1 lysophospholipase like 1 2 2
MIRT464457 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT465747 TMPPE transmembrane protein with metallophosphoesterase domain 2 2
MIRT468257 SFXN4 sideroflexin 4 2 2
MIRT469216 RICTOR RPTOR independent companion of MTOR complex 2 2 2
MIRT472045 NPAT nuclear protein, coactivator of histone transcription 2 2
MIRT481795 APEX1 apurinic/apyrimidinic endodeoxyribonuclease 1 2 2
MIRT500154 CREBBP CREB binding protein 2 2
MIRT506514 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 4
MIRT506915 KBTBD8 kelch repeat and BTB domain containing 8 2 6
MIRT513901 GRB10 growth factor receptor bound protein 10 2 6
MIRT519128 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 2 2
MIRT528121 FOXH1 forkhead box H1 2 2
MIRT528942 SFMBT2 Scm like with four mbt domains 2 2 2
MIRT540580 CEP89 centrosomal protein 89 2 2
MIRT545858 ZNF264 zinc finger protein 264 2 4
MIRT547147 PGM3 phosphoglucomutase 3 2 2
MIRT547434 MED4 mediator complex subunit 4 2 2
MIRT554650 ROBO1 roundabout guidance receptor 1 2 2
MIRT558524 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT559762 ABHD5 abhydrolase domain containing 5 2 2
MIRT560438 GOLGA7B golgin A7 family member B 2 2
MIRT561974 LRRC59 leucine rich repeat containing 59 2 2
MIRT562442 DDIT4 DNA damage inducible transcript 4 2 2
MIRT563489 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT568265 BMP2K BMP2 inducible kinase 2 2
MIRT572522 KIAA0232 KIAA0232 2 2
MIRT612801 LSM14A LSM14A, mRNA processing body assembly factor 2 2
MIRT621533 ZNF507 zinc finger protein 507 2 2
MIRT625205 GSTCD glutathione S-transferase C-terminal domain containing 2 2
MIRT625615 ZNF84 zinc finger protein 84 2 2
MIRT629215 C12orf66 chromosome 12 open reading frame 66 2 2
MIRT629509 AS3MT arsenite methyltransferase 2 2
MIRT629769 STK25 serine/threonine kinase 25 2 2
MIRT630908 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT632508 RAB13 RAB13, member RAS oncogene family 2 2
MIRT636871 ARSE arylsulfatase E (chondrodysplasia punctata 1) 2 2
MIRT637106 CXorf23 BCLAF1 and THRAP3 family member 3 2 2
MIRT637332 FAM9B family with sequence similarity 9 member B 2 2
MIRT637553 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT637639 ZNF431 zinc finger protein 431 2 2
MIRT637836 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT638326 RNF11 ring finger protein 11 2 2
MIRT638393 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT642450 CLUAP1 clusterin associated protein 1 2 2
MIRT642616 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT643133 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT644324 NFKBID NFKB inhibitor delta 2 2
MIRT645150 DIS3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 2
MIRT645673 ADK adenosine kinase 2 2
MIRT646091 MGST3 microsomal glutathione S-transferase 3 2 2
MIRT646858 SLC35E4 solute carrier family 35 member E4 2 2
MIRT650153 ZNF426 zinc finger protein 426 2 2
MIRT652483 TMEM181 transmembrane protein 181 2 2
MIRT653790 SIRPA signal regulatory protein alpha 2 2
MIRT655526 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 2
MIRT657077 JPH2 junctophilin 2 2 2
MIRT657322 HOOK3 hook microtubule tethering protein 3 2 2
MIRT662036 FUT2 fucosyltransferase 2 2 2
MIRT662322 ADM2 adrenomedullin 2 2 2
MIRT663211 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 2
MIRT663559 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663937 ZNF554 zinc finger protein 554 2 2
MIRT664689 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT664709 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT665291 ZFP14 ZFP14 zinc finger protein 2 2
MIRT665572 TXNL1 thioredoxin like 1 2 2
MIRT667068 PAOX polyamine oxidase 2 2
MIRT667304 MYO5A myosin VA 2 2
MIRT667442 METTL14 methyltransferase like 14 2 2
MIRT668048 GTPBP10 GTP binding protein 10 2 2
MIRT669604 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT671088 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT674361 SLC35E3 solute carrier family 35 member E3 2 2
MIRT674962 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT676394 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT676819 AGMAT agmatinase 2 2
MIRT676891 ENSA endosulfine alpha 2 2
MIRT677059 ZNF34 zinc finger protein 34 2 2
MIRT678424 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678735 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT678930 XPOT exportin for tRNA 2 2
MIRT678954 MYADM myeloid associated differentiation marker 2 2
MIRT679228 MAN2A2 mannosidase alpha class 2A member 2 2 2
MIRT679765 TLR6 toll like receptor 6 2 2
MIRT681992 HRH4 histamine receptor H4 2 2
MIRT687405 NSUN4 NOP2/Sun RNA methyltransferase family member 4 2 2
MIRT694570 RBMXL1 RNA binding motif protein, X-linked like 1 2 2
MIRT698449 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT706406 HAS2 hyaluronan synthase 2 2 2
MIRT706582 ZNF432 zinc finger protein 432 2 2
MIRT706838 VHLL VHL like 2 2
MIRT706909 DVL3 dishevelled segment polarity protein 3 2 2
MIRT707052 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT708583 C11orf54 chromosome 11 open reading frame 54 2 2
MIRT708988 CABP4 calcium binding protein 4 2 2
MIRT713041 ADRA2B adrenoceptor alpha 2B 2 2
MIRT713731 SUCO SUN domain containing ossification factor 2 2
MIRT714968 RAB21 RAB21, member RAS oncogene family 2 2
MIRT717485 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT722826 KLK2 kallikrein related peptidase 2 2 2
MIRT723305 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1245a Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (500nM)
hsa-miR-1245a Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (500nM)
hsa-miR-1245a Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-1245a Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-1245a Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-1245a Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission