pre-miRNA Information
pre-miRNA hsa-mir-412   
Genomic Coordinates chr14: 101065447 - 101065537
Synonyms MIRN412, hsa-mir-412, MIR412
Description Homo sapiens miR-412 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-412-3p
Sequence 54| ACUUCACCUGGUCCACUAGCCGU |76
Evidence Not_experimental
Experiments
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
rs61992671 18 GWAS
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs369997462 1 dbSNP
rs1439693090 7 dbSNP
rs1301668924 11 dbSNP
rs534204576 13 dbSNP
rs775386036 14 dbSNP
rs762832140 15 dbSNP
rs1203323285 16 dbSNP
rs61992671 18 dbSNP
rs1022012324 19 dbSNP
rs1207609936 20 dbSNP
rs139967426 21 dbSNP
rs539487075 22 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DYNC2LI1   
Synonyms CGI-60, D2LIC, LIC3
Description dynein cytoplasmic 2 light intermediate chain 1
Transcript NM_015522   
Other Transcripts NM_016008   
Expression
Putative miRNA Targets on DYNC2LI1
3'UTR of DYNC2LI1
(miRNA target sites are highlighted)
>DYNC2LI1|NM_015522|3'UTR
   1 AATTCATTTGATGTAGATGAACCTGTTCACTGGAAAATTACAGCAATTTATTAAAACCTCAGTAAGAGCAAAACAAGGAA
  81 GAAGATTCCTTATATCTTCTTGTTAGACATCTTCTGTGATTGTTATGGCATATTACACCAATCAGAGAAATAGAGTTTTA
 161 AAGTAGTGGTTTGATATTGATTTTATAATCTCTGTAAAAATGAAGATAAAAAGCCAGATTGTACAAAAGTCACCTGACAA
 241 AGACTAGATGAAGCTACAACTTTAAGCAAGGGGTAGAGTTGTAATAGCCTTCACCATCACTCTGTATTTTACATTCATTT
 321 CGTTTCTGTCACTTATTCAGTATCTTTTTATCATCTGACAGCTAATTAAATTATAAAGTTGCTATGATGGTAACACAAGT
 401 TCTTCAAATACAATAATAAATATCATCATCTGGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ugccgaucacCUGGUCCACUUCa 5'
                    |||:|| ||||| 
Target 5' acctgacaaaGACTAGATGAAGc 3'
232 - 254 129.00 -12.50
2
miRNA  3' ugccgaUCACCUG-GUCCACUUca 5'
                | | ||: :|| ||||  
Target 5' -aattcATTTGATGTAGATGAAcc 3'
1 - 23 101.00 -6.70
3
miRNA  3' ugccgaucaccugguccACUUCa 5'
                           ||||| 
Target 5' tataatctctgtaaaaaTGAAGa 3'
184 - 206 100.00 -5.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31501523 17 COSMIC
COSN18057972 30 COSMIC
COSN13996300 58 COSMIC
COSN31564210 60 COSMIC
COSN31580903 88 COSMIC
COSN30481088 97 COSMIC
COSN30137714 130 COSMIC
COSN30465974 146 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773057615 5 dbSNP
rs1202941782 7 dbSNP
rs760592460 16 dbSNP
rs766353351 18 dbSNP
rs559002219 23 dbSNP
rs996902213 24 dbSNP
rs1368965610 26 dbSNP
rs1431926993 29 dbSNP
rs1225539328 33 dbSNP
rs528204878 42 dbSNP
rs1401286583 43 dbSNP
rs551245502 44 dbSNP
rs752908990 46 dbSNP
rs1299140030 58 dbSNP
rs1465834224 59 dbSNP
rs1388718812 61 dbSNP
rs988199994 62 dbSNP
rs1410601229 63 dbSNP
rs766411924 64 dbSNP
rs1179371798 65 dbSNP
rs1021366792 75 dbSNP
rs1484033236 80 dbSNP
rs866302980 90 dbSNP
rs1324521267 91 dbSNP
rs1011710789 93 dbSNP
rs185242405 100 dbSNP
rs1257472916 101 dbSNP
rs1205827138 110 dbSNP
rs903257412 113 dbSNP
rs1287885711 122 dbSNP
rs530662999 124 dbSNP
rs1226619273 127 dbSNP
rs981725776 128 dbSNP
rs115582561 129 dbSNP
rs140736574 139 dbSNP
rs567597883 139 dbSNP
rs535825665 141 dbSNP
rs1318536817 151 dbSNP
rs1400516960 153 dbSNP
rs555816403 156 dbSNP
rs1470048207 159 dbSNP
rs189317654 164 dbSNP
rs1156366003 175 dbSNP
rs1355113209 177 dbSNP
rs986073760 178 dbSNP
rs142546198 179 dbSNP
rs552993236 187 dbSNP
rs1421926761 194 dbSNP
rs62136410 212 dbSNP
rs1461969760 222 dbSNP
rs971864597 226 dbSNP
rs919036199 239 dbSNP
rs1261314287 242 dbSNP
rs1244712204 244 dbSNP
rs1487081846 245 dbSNP
rs1317688910 246 dbSNP
rs535511412 249 dbSNP
rs949144257 251 dbSNP
rs1191980592 256 dbSNP
rs982244640 258 dbSNP
rs1478335940 260 dbSNP
rs919697297 267 dbSNP
rs578122629 273 dbSNP
rs543699026 286 dbSNP
rs763107897 295 dbSNP
rs1456392641 296 dbSNP
rs1386983400 297 dbSNP
rs557217624 298 dbSNP
rs1367221159 300 dbSNP
rs767592831 309 dbSNP
rs893389226 320 dbSNP
rs944323376 323 dbSNP
rs1262588455 331 dbSNP
rs1209313473 341 dbSNP
rs1041666909 349 dbSNP
rs900083353 351 dbSNP
rs903330566 353 dbSNP
rs996995662 360 dbSNP
rs1341907413 361 dbSNP
rs1393181694 362 dbSNP
rs1295785121 364 dbSNP
rs1432533722 371 dbSNP
rs1326655652 385 dbSNP
rs752507529 387 dbSNP
rs1322355405 391 dbSNP
rs1384547291 397 dbSNP
rs556800371 399 dbSNP
rs997625527 407 dbSNP
rs1428953833 412 dbSNP
rs1032470388 413 dbSNP
rs893926897 414 dbSNP
rs1373829101 417 dbSNP
rs372001862 422 dbSNP
rs534749850 422 dbSNP
rs889125216 423 dbSNP
rs370097513 424 dbSNP
rs1271060680 425 dbSNP
rs1223901450 428 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 51626.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000260605.8 | 3UTR | AUUAUACUGUGAAUUAACUAUUGUGGCAAUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
138 hsa-miR-412-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005780 ACVR1C activin A receptor type 1C 1 1
MIRT062013 YOD1 YOD1 deubiquitinase 2 2
MIRT345112 ATXN7L3 ataxin 7 like 3 2 2
MIRT383735 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 2
MIRT396956 CELF1 CUGBP Elav-like family member 1 2 2
MIRT439280 XIAP X-linked inhibitor of apoptosis 1 1
MIRT439313 VAT1 vesicle amine transport 1 1 1
MIRT439375 TUBA1A tubulin alpha 1a 1 1
MIRT439418 TMOD1 tropomodulin 1 1 1
MIRT439503 SURF4 surfeit 4 1 1
MIRT439563 SON SON DNA binding protein 1 1
MIRT439598 SLC3A2 solute carrier family 3 member 2 1 1
MIRT439670 SETD1B SET domain containing 1B 1 1
MIRT439767 RMND5A required for meiotic nuclear division 5 homolog A 1 1
MIRT439922 PPL periplakin 1 1
MIRT439947 PLEKHA6 pleckstrin homology domain containing A6 1 1
MIRT439952 PLCB4 phospholipase C beta 4 1 1
MIRT439961 PKD1 polycystin 1, transient receptor potential channel interacting 1 1
MIRT440005 PEG3 paternally expressed 3 1 1
MIRT440061 OSBPL8 oxysterol binding protein like 8 1 1
MIRT440166 MYH14 myosin heavy chain 14 1 1
MIRT440276 MAPK8IP1 mitogen-activated protein kinase 8 interacting protein 1 1 1
MIRT440437 IPO13 importin 13 1 1
MIRT440441 INTS3 integrator complex subunit 3 1 1
MIRT440448 INS insulin 1 1
MIRT440461 IGF2R insulin like growth factor 2 receptor 1 1
MIRT440472 IARS isoleucyl-tRNA synthetase 1 1
MIRT440530 GUCY1A3 guanylate cyclase 1 soluble subunit alpha 1 1
MIRT440542 GOLGA2 golgin A2 1 1
MIRT440569 GIGYF1 GRB10 interacting GYF protein 1 1 1
MIRT440608 FTSJD2 cap methyltransferase 1 1 1
MIRT440750 EEF1A2 eukaryotic translation elongation factor 1 alpha 2 1 1
MIRT440781 DOT1L DOT1 like histone lysine methyltransferase 1 1
MIRT440804 DNAJA4 DnaJ heat shock protein family (Hsp40) member A4 1 1
MIRT440867 CSDE1 cold shock domain containing E1 1 1
MIRT440890 CPEB4 cytoplasmic polyadenylation element binding protein 4 1 1
MIRT440917 COL1A1 collagen type I alpha 1 chain 1 1
MIRT440967 CDH22 cadherin 22 1 1
MIRT440968 CDH2 cadherin 2 1 1
MIRT441024 CALR calreticulin 1 1
MIRT441278 ACTB actin beta 1 1
MIRT448421 TNFAIP3 TNF alpha induced protein 3 2 2
MIRT462833 BCL3 B-cell CLL/lymphoma 3 2 2
MIRT465062 TSR1 TSR1, ribosome maturation factor 2 2
MIRT476050 GRSF1 G-rich RNA sequence binding factor 1 2 2
MIRT485318 MZT1 mitotic spindle organizing protein 1 2 4
MIRT493584 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 6
MIRT494567 BAK1 BCL2 antagonist/killer 1 2 2
MIRT497393 RALY RALY heterogeneous nuclear ribonucleoprotein 2 2
MIRT503250 ZNF257 zinc finger protein 257 2 10
MIRT503656 ZNF138 zinc finger protein 138 2 10
MIRT505882 RNF219 ring finger protein 219 2 2
MIRT507525 DSTN destrin, actin depolymerizing factor 2 4
MIRT510663 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT514682 ZNF701 zinc finger protein 701 2 4
MIRT515370 ZNF208 zinc finger protein 208 2 6
MIRT525237 KCNJ12 potassium voltage-gated channel subfamily J member 12 2 2
MIRT527963 MTAP methylthioadenosine phosphorylase 2 2
MIRT528482 STAMBPL1 STAM binding protein like 1 2 2
MIRT529909 C1orf64 steroid receptor associated and regulated protein 2 4
MIRT531558 SRD5A1 steroid 5 alpha-reductase 1 2 2
MIRT532234 KLF2 Kruppel like factor 2 2 4
MIRT532480 HOXA13 homeobox A13 2 2
MIRT535544 P2RY2 purinergic receptor P2Y2 2 2
MIRT547311 NR1D2 nuclear receptor subfamily 1 group D member 2 2 2
MIRT551795 ZNF117 zinc finger protein 117 2 4
MIRT554939 RAP1A RAP1A, member of RAS oncogene family 2 2
MIRT558171 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT568771 LY6K lymphocyte antigen 6 family member K 2 2
MIRT570766 ZNF99 zinc finger protein 99 2 2
MIRT572405 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT573396 DLC1 DLC1 Rho GTPase activating protein 2 2
MIRT610403 RXRB retinoid X receptor beta 2 2
MIRT610886 SCN8A sodium voltage-gated channel alpha subunit 8 2 2
MIRT611197 TMEM105 transmembrane protein 105 2 2
MIRT611244 ZNF550 zinc finger protein 550 2 2
MIRT615669 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 4
MIRT617974 DOCK4 dedicator of cytokinesis 4 2 2
MIRT619150 ZNF326 zinc finger protein 326 2 2
MIRT619608 MKKS McKusick-Kaufman syndrome 2 2
MIRT621053 DGKD diacylglycerol kinase delta 2 2
MIRT623665 HRK harakiri, BCL2 interacting protein 2 2
MIRT624883 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT624939 MARCH2 membrane associated ring-CH-type finger 2 2 2
MIRT634198 TMOD2 tropomodulin 2 2 4
MIRT636727 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT637741 POLR3K RNA polymerase III subunit K 2 2
MIRT638002 ZC3H13 zinc finger CCCH-type containing 13 2 2
MIRT640395 ZNF785 zinc finger protein 785 2 2
MIRT640505 ANTXR1 anthrax toxin receptor 1 2 2
MIRT641293 SLAMF1 signaling lymphocytic activation molecule family member 1 2 2
MIRT641863 STOML1 stomatin like 1 2 2
MIRT642600 C14orf180 chromosome 14 open reading frame 180 2 2
MIRT642895 CASP1 caspase 1 2 2
MIRT643967 FHL2 four and a half LIM domains 2 2 4
MIRT645237 KCTD12 potassium channel tetramerization domain containing 12 2 2
MIRT646621 CENPL centromere protein L 2 2
MIRT648620 CYB561A3 cytochrome b561 family member A3 2 2
MIRT648908 ZNF551 zinc finger protein 551 2 2
MIRT649439 HIBADH 3-hydroxyisobutyrate dehydrogenase 2 2
MIRT650637 LTF lactotransferrin 2 2
MIRT650971 STARD3NL STARD3 N-terminal like 2 2
MIRT651067 ZNF518B zinc finger protein 518B 2 4
MIRT652384 TMEM55A phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 2 2
MIRT653958 SEPN1 selenoprotein N 2 2
MIRT656885 KIF1C kinesin family member 1C 2 2
MIRT657965 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT658080 FOXR2 forkhead box R2 2 2
MIRT662570 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT663089 METTL10 EEF1A lysine methyltransferase 2 2 2
MIRT683705 ZNF195 zinc finger protein 195 2 2
MIRT683835 ZNF682 zinc finger protein 682 2 2
MIRT706811 APOL4 apolipoprotein L4 2 2
MIRT707575 DYNC2LI1 dynein cytoplasmic 2 light intermediate chain 1 2 2
MIRT708606 ZNF260 zinc finger protein 260 2 2
MIRT708859 TMSB4X thymosin beta 4, X-linked 2 2
MIRT709861 PDIK1L PDLIM1 interacting kinase 1 like 2 2
MIRT709987 RBM41 RNA binding motif protein 41 2 2
MIRT710098 KPNA5 karyopherin subunit alpha 5 2 2
MIRT710211 ENAH ENAH, actin regulator 2 2
MIRT710868 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 2 2
MIRT710986 SUSD5 sushi domain containing 5 2 2
MIRT711460 RNF145 ring finger protein 145 2 2
MIRT712302 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT713609 SYTL4 synaptotagmin like 4 2 2
MIRT713789 MAK16 MAK16 homolog 2 2
MIRT715480 MYO9B myosin IXB 2 2
MIRT716328 POU5F1 POU class 5 homeobox 1 2 2
MIRT717252 TMEM246 transmembrane protein 246 2 2
MIRT718077 CLIC5 chloride intracellular channel 5 2 2
MIRT718463 EED embryonic ectoderm development 2 2
MIRT718645 NKPD1 NTPase KAP family P-loop domain containing 1 2 2
MIRT718982 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 2
MIRT721078 RPS9 ribosomal protein S9 2 2
MIRT721419 SEC24A SEC24 homolog A, COPII coat complex component 2 2
MIRT721863 CENPJ centromere protein J 2 2
MIRT722492 PNKD paroxysmal nonkinesigenic dyskinesia 2 2
MIRT723391 CALN1 calneuron 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-412 Gemcitabine approved 60750 Northern blot Mz-ChA-1 human cholangiocarcinoma cell lines 16762633 2006 down-regulated
miR-412 Progesterone approved 5994 Microarray Breast cancer 22330642 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-412 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-412 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-412-3p Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-412-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-412-3p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-miR-412-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (RKO)
hsa-miR-412-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-412-3p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer cell line (A2780)
hsa-miR-412-3p Doxorubicin 31703 NSC123127 approved sensitive High Anaplastic Thyroid Cancer tissue
hsa-miR-412-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-412-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-412-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-412-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-412-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-412-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-412-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-412-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-412-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission