pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4477a |
Genomic Coordinates | chr9: 41233755 - 41233835 |
Description | Homo sapiens miR-4477a stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4477a | ||||||||||||||||||||||||||||||||||||||||||
Sequence | 48| CUAUUAAGGACAUUUGUGAUUC |69 | ||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | BBOX1 | ||||||||||||||||||||
Synonyms | BBH, BBOX, G-BBH, gamma-BBH | ||||||||||||||||||||
Description | gamma-butyrobetaine hydroxylase 1 | ||||||||||||||||||||
Transcript | NM_003986 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on BBOX1 | |||||||||||||||||||||
3'UTR of BBOX1 (miRNA target sites are highlighted) |
>BBOX1|NM_003986|3'UTR 1 AGTCACCTGTAGATAATTTTAATAAGATTCCAATGACCATATTTTGTGAGATATGGCACATTATTCACAGACCATGATCT 81 TTGTGATTTACATATAATTTCCTTAACAATGAACATGTAACTTCTCTCACAAGAGTACTCTTTACTTTGTAATCATATAC 161 AATGTCAACTTTTTAGATGTTTCACCACTCTTTTGCAAATAAAGCATCCTTTCTGCTCTGTTGCATGCCTGCTCTAATTT 241 CTTTTGCCCATATATGAGTATCTCCAGAATGTCTACAAATAGTTTTTGTAGCAAATGAAAATTTCTTCAAATAAGCCTTT 321 TGTTTCAAATAAAACTTGTCTCAAAACATGCTTCAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HeLa |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A
HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B
HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A
HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + A |
Location of target site | ENST00000528583.1 | 3UTR | AUAAGAUUCCAAUGACC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset Chi_124B_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + B |
Location of target site | ENST00000528583.1 | 3UTR | AUAAGAUUCCAAUGACC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset Chi_ControlA_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell Control A |
Location of target site | ENST00000528583.1 | 3UTR | AUAAGAUUCCAAUGACC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset Chi_ControlB_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell Control B |
Location of target site | ENST00000528583.1 | 3UTR | AUAAGAUUCCAAUGACC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
134 hsa-miR-4477a Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT055843 | PLEKHA1 | pleckstrin homology domain containing A1 | ![]() |
![]() |
2 | 10 | ||||||
MIRT061259 | AMOTL1 | angiomotin like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT071895 | BTF3L4 | basic transcription factor 3 like 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT076933 | MLLT6 | MLLT6, PHD finger containing | ![]() |
![]() |
2 | 2 | ||||||
MIRT078652 | ICT1 | mitochondrial ribosomal protein L58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT083633 | PRNP | prion protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT091629 | RPL15 | ribosomal protein L15 | ![]() |
![]() |
2 | 4 | ||||||
MIRT107076 | PPP6C | protein phosphatase 6 catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT111191 | TRIM33 | tripartite motif containing 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT114515 | ARF6 | ADP ribosylation factor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT175250 | PSAT1 | phosphoserine aminotransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT175430 | ACSL4 | acyl-CoA synthetase long chain family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT178687 | FAM102B | family with sequence similarity 102 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT189771 | CDADC1 | cytidine and dCMP deaminase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT229450 | RPL10 | ribosomal protein L10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT244899 | PHF6 | PHD finger protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT249189 | AKIRIN1 | akirin 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT261134 | TRIM8 | tripartite motif containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT275561 | ZIC5 | Zic family member 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT275652 | ABHD13 | abhydrolase domain containing 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT288082 | UTP18 | UTP18, small subunit processome component | ![]() |
![]() |
2 | 2 | ||||||
MIRT303605 | MTHFD2 | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase | ![]() |
![]() |
2 | 2 | ||||||
MIRT307924 | ARL8B | ADP ribosylation factor like GTPase 8B | ![]() |
![]() |
2 | 2 | ||||||
MIRT316787 | FOXC1 | forkhead box C1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT326910 | SCML2 | Scm polycomb group protein like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT327713 | SPIN4 | spindlin family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT331632 | AASDHPPT | aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT342506 | TMOD3 | tropomodulin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT354470 | LRRC58 | leucine rich repeat containing 58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT378711 | TRIM24 | tripartite motif containing 24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT407462 | YDJC | YdjC chitooligosaccharide deacetylase homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT408226 | SMAD5 | SMAD family member 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT441824 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT442783 | CHD8 | chromodomain helicase DNA binding protein 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443184 | NHS | NHS actin remodeling regulator | ![]() |
![]() |
2 | 4 | ||||||
MIRT447615 | CUL3 | cullin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450156 | DSEL | dermatan sulfate epimerase-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT454801 | NEDD9 | neural precursor cell expressed, developmentally down-regulated 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463050 | ZNF644 | zinc finger protein 644 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467400 | SOCS3 | suppressor of cytokine signaling 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468174 | SGMS1 | sphingomyelin synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468949 | RPS14 | ribosomal protein S14 | ![]() |
![]() |
2 | 6 | ||||||
MIRT469835 | R3HDM4 | R3H domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470724 | POFUT1 | protein O-fucosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT470902 | PLIN3 | perilipin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472467 | NAPG | NSF attachment protein gamma | ![]() |
![]() |
2 | 12 | ||||||
MIRT472602 | NAA50 | N(alpha)-acetyltransferase 50, NatE catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT492350 | SEMA7A | semaphorin 7A (John Milton Hagen blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT493840 | FOXN3 | forkhead box N3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT496318 | DOCK9 | dedicator of cytokinesis 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500159 | CLEC2D | C-type lectin domain family 2 member D | ![]() |
![]() |
2 | 8 | ||||||
MIRT500535 | XPO4 | exportin 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT503916 | FBXL13 | F-box and leucine rich repeat protein 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT504003 | SAT1 | spermidine/spermine N1-acetyltransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT505647 | SHMT1 | serine hydroxymethyltransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506574 | MIER3 | MIER family member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT506945 | HS3ST3B1 | heparan sulfate-glucosamine 3-sulfotransferase 3B1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT508196 | RPS19 | ribosomal protein S19 | ![]() |
![]() |
2 | 6 | ||||||
MIRT511417 | HSPA13 | heat shock protein family A (Hsp70) member 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512326 | ACTB | actin beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT515376 | RPL7 | ribosomal protein L7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520422 | TUBG1 | tubulin gamma 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT524844 | ARPP19 | cAMP regulated phosphoprotein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526320 | UGT2A1 | UDP glucuronosyltransferase family 2 member A1 complex locus | ![]() |
![]() |
2 | 2 | ||||||
MIRT526561 | UGT2A2 | UDP glucuronosyltransferase family 2 member A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528027 | FEZ2 | fasciculation and elongation protein zeta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529874 | RBM43 | RNA binding motif protein 43 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530826 | CLEC4D | C-type lectin domain family 4 member D | ![]() |
![]() |
2 | 2 | ||||||
MIRT531334 | GDPD1 | glycerophosphodiester phosphodiesterase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT532068 | CCNB1 | cyclin B1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT532870 | ZNF566 | zinc finger protein 566 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535580 | NUP35 | nucleoporin 35 | ![]() |
![]() |
2 | 2 | ||||||
MIRT537644 | ERGIC2 | ERGIC and golgi 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT537725 | ELAVL2 | ELAV like RNA binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538894 | BRI3BP | BRI3 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT538945 | BMP2K | BMP2 inducible kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT540703 | PDPK1 | 3-phosphoinositide dependent protein kinase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT543210 | TMEM117 | transmembrane protein 117 | ![]() |
![]() |
2 | 3 | ||||||
MIRT543357 | LYRM2 | LYR motif containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544905 | CLSPN | claspin | ![]() |
![]() |
2 | 2 | ||||||
MIRT545532 | ARF3 | ADP ribosylation factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546446 | SMOC1 | SPARC related modular calcium binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546882 | PURB | purine rich element binding protein B | ![]() |
![]() |
2 | 4 | ||||||
MIRT547440 | MED13 | mediator complex subunit 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548027 | GOLIM4 | golgi integral membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548673 | CRNKL1 | crooked neck pre-mRNA splicing factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT550435 | LLGL2 | LLGL2, scribble cell polarity complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT551850 | RPS3 | ribosomal protein S3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556072 | MRFAP1 | Morf4 family associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556554 | LIMS1 | LIM zinc finger domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557132 | HOXA13 | homeobox A13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557875 | FEM1B | fem-1 homolog B | ![]() |
![]() |
2 | 4 | ||||||
MIRT558146 | ELK4 | ELK4, ETS transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT558862 | CD2AP | CD2 associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT558884 | CCNE1 | cyclin E1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT558907 | CBX5 | chromobox 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559175 | BRAP | BRCA1 associated protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT560860 | GAL3ST3 | galactose-3-O-sulfotransferase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561729 | PPIF | peptidylprolyl isomerase F | ![]() |
![]() |
2 | 2 | ||||||
MIRT564024 | CEBPB | CCAAT/enhancer binding protein beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT564366 | TRMT5 | tRNA methyltransferase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564609 | ZNF703 | zinc finger protein 703 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565494 | AZF1 | azoospermia factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565577 | SLC6A8 | solute carrier family 6 member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566947 | LEPROT | leptin receptor overlapping transcript | ![]() |
![]() |
2 | 2 | ||||||
MIRT567293 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567308 | HMGN2 | high mobility group nucleosomal binding domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568048 | CHSY1 | chondroitin sulfate synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571807 | PHF19 | PHD finger protein 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609234 | RBM23 | RNA binding motif protein 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610328 | SSX5 | SSX family member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT611428 | UGT8 | UDP glycosyltransferase 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT611709 | SLFN13 | schlafen family member 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT612069 | CEP135 | centrosomal protein 135 | ![]() |
![]() |
2 | 4 | ||||||
MIRT617676 | JRKL | JRK like | ![]() |
![]() |
2 | 2 | ||||||
MIRT623684 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635634 | PRR15L | proline rich 15 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT636422 | MBOAT2 | membrane bound O-acyltransferase domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637011 | GPATCH11 | G-patch domain containing 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644150 | C4orf3 | chromosome 4 open reading frame 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648562 | MEMO1 | mediator of cell motility 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650752 | WNT16 | Wnt family member 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651914 | UEVLD | UEV and lactate/malate dehyrogenase domains | ![]() |
![]() |
2 | 2 | ||||||
MIRT653556 | SLC38A7 | solute carrier family 38 member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692277 | XRN2 | 5'-3' exoribonuclease 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697650 | WNK1 | WNK lysine deficient protein kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703876 | ERCC6 | ERCC excision repair 6, chromatin remodeling factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT704615 | CLIP1 | CAP-Gly domain containing linker protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708562 | BBOX1 | gamma-butyrobetaine hydroxylase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709614 | KBTBD6 | kelch repeat and BTB domain containing 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712955 | SGCD | sarcoglycan delta | ![]() |
![]() |
2 | 2 | ||||||
MIRT713502 | DCAF17 | DDB1 and CUL4 associated factor 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720239 | GPBP1 | GC-rich promoter binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724255 | GLUD1 | glutamate dehydrogenase 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|