pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3152 |
Genomic Coordinates | chr9: 18573306 - 18573379 |
Description | Homo sapiens miR-3152 stem-loop |
Comment | Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method . |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3152-5p | ||||||||||||||||||||||||
Sequence | 11| AUUGCCUCUGUUCUAACACAAG |32 | ||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TROVE2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | RO60, RORNP, SSA2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | TROVE domain family member 2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_001173524 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other Transcripts | NM_001042369 , NM_001042370 , NM_001173525 , NM_004600 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on TROVE2 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of TROVE2 (miRNA target sites are highlighted) |
>TROVE2|NM_001173524|3'UTR 1 CCATAAGCAGCAGCACGATCCAGAGATCCATTGCCATCAGTGATCTCACTAAAAATATACAGCTACTTCCCAGCTAATCT 81 CCACCCAATGAATGATGATGGTATAGTATGTGCATAATGGAAAGTTACCTTACTGAAAAAAAAAAAAGAAGGAAAAATAA 161 GATGGGCCCAAAGGTCTATCTACTAAACTAGCTCTTGGGGAAATAGCTTCAGGATACTGTAGTTTCCTCTATCTAATAGA 241 GAACTTTTTGTTAACAGACACTGTAAAATAGTTTTGCTTTGTTGAATAATACGTGTGTACCTAAAAGAGGTAAGAGCAAA 321 AAGTGTAATTCCACATCATGTTACTTGAGAAGTGCTTAACGTTTTCTTAAATGTTTTCATTGGGAAAGGACAGCTTTGAT 401 AATGTCCAAATACTCTGAAATGCACTAGACCATATAACTGTGATGAAATATGAAACTCATCTGTAAACTTTTATACCAAG 481 GGGGTAAAAAAAAAAACTAAGGCATTTGATTAAATTATGAATGAGTTTTACAAATTCCTTTCAGAGTTTTACTAAGATCA 561 CACAAATAACAGCTTTCTTATTCAGTGAAAAAGATATTTTATTTCTGATGTTTTATTTGCACTTGTGGAATATGTTACCA 641 TTAATCAGAAACATCATGGCAACCCCTAAGAATAGACTAAGTTTGTGTTGGCTGAGGGATTCTATTTGGTTTGCTTTTTT 721 TTTTTTGCTTTGTTATATTTTATTGCTACAAGGGGTGTGACTTGATAATGATTTCCTCTGAATTATAATAACATAGCCAG 801 ATGTAGTCTCACACTGTTTTTCATACTCTTAAGTGTAAATAATATAAAATGTTTCAAGCGCTTAACTCCCCCTCATTCAC 881 AAAGTATAACAATTAAAATCTCAACTATAACCAGTTTAGCTTTTTCCTTACTTTTAAAATAAAATTTTTTACTTTTAACT 961 ATTTTTTTAGTTAATATTTTTAAAAGTATACATGTCAATGGCCTCTTTGTCCATTATTCATTTTGTGGCAAAATATTCTT 1041 CTTTGATAGTGTAAACAAATAATAAAGCAATCTAGGTCCTTTAGGTTTGAAAGGCAATTTTTGAGTAGCATATTACCAGC 1121 TAGCCAGTCACTAGGAATTTTTTTCAGTATTATTTGTATGTATTAAACTTTTCATTACACTAAAGTGCATTATTTTATTG 1201 AGCAAGTATCCTTCATTGTGAGGTTTAACATTAAAGCAATCTGTTGAAATGCCAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HeLa |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A
HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B
HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A
HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + A |
Location of target site | ENST00000432079.1 | 3UTR | UAGUGAGGCAAGAUGCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset Chi_124B_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + B |
Location of target site | ENST00000432079.1 | 3UTR | UAGUGAGGCAAGAUGCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset Chi_ControlA_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell Control A |
Location of target site | ENST00000432079.1 | 3UTR | UAGUGAGGCAAGAUGCUAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset Chi_ControlB_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell Control B |
Location of target site | ENST00000432079.1 | 3UTR | UAGUGAGGCAAGAUGCUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
75 hsa-miR-3152-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT092535 | KBTBD8 | kelch repeat and BTB domain containing 8 | ![]() |
![]() |
2 | 6 | ||||||
MIRT461731 | NDUFA2 | NADH:ubiquinone oxidoreductase subunit A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468456 | SET | SET nuclear proto-oncogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT482192 | AHR | aryl hydrocarbon receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT507923 | BZW1 | basic leucine zipper and W2 domains 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512208 | C18orf25 | chromosome 18 open reading frame 25 | ![]() |
![]() |
2 | 6 | ||||||
MIRT526238 | STARD4 | StAR related lipid transfer domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536131 | MAPK14 | mitogen-activated protein kinase 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536280 | LIMA1 | LIM domain and actin binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544251 | LRIF1 | ligand dependent nuclear receptor interacting factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548054 | GOLGA7 | golgin A7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563443 | ISCA1 | iron-sulfur cluster assembly 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565643 | SIX4 | SIX homeobox 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT614870 | PDE12 | phosphodiesterase 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT614923 | MARCH6 | membrane associated ring-CH-type finger 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615793 | FAM124A | family with sequence similarity 124 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT618557 | VLDLR | very low density lipoprotein receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT622147 | SORBS2 | sorbin and SH3 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622390 | RSBN1 | round spermatid basic protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624185 | DDX19B | DEAD-box helicase 19B | ![]() |
![]() |
2 | 2 | ||||||
MIRT624448 | CALCOCO2 | calcium binding and coiled-coil domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625340 | TAPBP | TAP binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT625370 | IRGQ | immunity related GTPase Q | ![]() |
![]() |
2 | 2 | ||||||
MIRT627276 | WSB1 | WD repeat and SOCS box containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627746 | RAD54L2 | RAD54 like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629578 | RFC2 | replication factor C subunit 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT630537 | LGALS8 | galectin 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT630559 | C3orf36 | chromosome 3 open reading frame 36 | ![]() |
![]() |
2 | 4 | ||||||
MIRT630568 | SOWAHA | sosondowah ankyrin repeat domain family member A | ![]() |
![]() |
2 | 4 | ||||||
MIRT630763 | MSANTD3 | Myb/SANT DNA binding domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635424 | LRP10 | LDL receptor related protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636011 | GNPNAT1 | glucosamine-phosphate N-acetyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636337 | PHAX | phosphorylated adaptor for RNA export | ![]() |
![]() |
2 | 2 | ||||||
MIRT638413 | POU3F2 | POU class 3 homeobox 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639358 | INIP | INTS3 and NABP interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT642124 | DYRK1A | dual specificity tyrosine phosphorylation regulated kinase 1A | ![]() |
![]() |
2 | 4 | ||||||
MIRT642828 | KIAA0319 | KIAA0319 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644017 | NUCB1 | nucleobindin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644038 | WWC2 | WW and C2 domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644153 | GIN1 | gypsy retrotransposon integrase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644649 | SNX9 | sorting nexin 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645798 | OMA1 | OMA1 zinc metallopeptidase | ![]() |
![]() |
2 | 2 | ||||||
MIRT647633 | FAIM2 | Fas apoptotic inhibitory molecule 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648528 | KIAA1143 | KIAA1143 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648851 | PDLIM3 | PDZ and LIM domain 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648880 | TUBGCP5 | tubulin gamma complex associated protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650777 | TNFRSF10A | TNF receptor superfamily member 10a | ![]() |
![]() |
2 | 2 | ||||||
MIRT654200 | RNF19B | ring finger protein 19B | ![]() |
![]() |
2 | 2 | ||||||
MIRT654508 | RAB5B | RAB5B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT655249 | PEX26 | peroxisomal biogenesis factor 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656089 | MTA3 | metastasis associated 1 family member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656599 | LRRC55 | leucine rich repeat containing 55 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659194 | CYBB | cytochrome b-245 beta chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT660000 | C1orf115 | chromosome 1 open reading frame 115 | ![]() |
![]() |
2 | 4 | ||||||
MIRT661715 | KLF8 | Kruppel like factor 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661813 | PRPSAP1 | phosphoribosyl pyrophosphate synthetase associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT668360 | FGD4 | FYVE, RhoGEF and PH domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679734 | CABP4 | calcium binding protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708616 | NUDT18 | nudix hydrolase 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709034 | TROVE2 | TROVE domain family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709573 | DMGDH | dimethylglycine dehydrogenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT709665 | AJAP1 | adherens junctions associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709874 | TRAF1 | TNF receptor associated factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710821 | NLRP12 | NLR family pyrin domain containing 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710883 | PARL | presenilin associated rhomboid like | ![]() |
![]() |
2 | 2 | ||||||
MIRT711547 | LCAT | lecithin-cholesterol acyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT712017 | STX1B | syntaxin 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT713058 | BLVRA | biliverdin reductase A | ![]() |
![]() |
2 | 2 | ||||||
MIRT713129 | THRB | thyroid hormone receptor beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT713878 | MOB3A | MOB kinase activator 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT714154 | NXPH3 | neurexophilin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719755 | FLYWCH1 | FLYWCH-type zinc finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720213 | KCNK1 | potassium two pore domain channel subfamily K member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722728 | BRMS1 | breast cancer metastasis suppressor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725652 | ABI2 | abl interactor 2 | ![]() |
![]() |
2 | 2 |