pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4680 |
Genomic Coordinates | chr10: 110898090 - 110898155 |
Description | Homo sapiens miR-4680 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4680-5p | |||||||||||||||||||||||||||||||||
Sequence | 5| AGAACUCUUGCAGUCUUAGAUGU |27 | |||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | RGP1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | KIAA0258 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | RGP1 homolog, RAB6A GEF complex partner 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_001080496 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on RGP1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of RGP1 (miRNA target sites are highlighted) |
>RGP1|NM_001080496|3'UTR 1 AACTGGCCCACCCTGGTGCTAGTTCCTTCCGGATACTGAGAACTCAGCACCTGGACTCTAATGGGACCCACTTTTTCCAC 81 CTGGGGTCCAATGTCGTGGACAGTGAGAGTCGGGCTTTCAGCTATAGCATTAATTTATTTGTTCAGAATACATTGGCAGC 161 TGCTAGTGGTTTCCCTGGAAGTGGCAGCAGCAGTGAGCAGTCAGCAGATGGATGATCAGTTGAGTTTAGCTGGAGTGGGG 241 AGCAGGAGCCCCAGGAACAGGGGTGTTGGCTGAGCCCCATTCTGGGTCAGGCCCTCCCCCTTTGCAGGGCAGCCGAGGGT 321 CAGATTTTTGCACCAAGGAGAACTGGCAGGTTCCTGCCTCCTGACGTACCTCACACCCAGCCGGGAAGTCGAT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HeLa |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A
HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B
HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A
HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + A |
Location of target site | ENST00000378078.4 | 3UTR | CGGAGUUCACAGUGGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset Chi_124B_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + B |
Location of target site | ENST00000378078.4 | 3UTR | CGGAGUUCACAGUGGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset Chi_ControlA_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell Control A |
Location of target site | ENST00000378078.4 | 3UTR | CGGAGUUCACAGUGGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset Chi_ControlB_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell Control B |
Location of target site | ENST00000378078.4 | 3UTR | CGGAGUUCACAGUGGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
133 hsa-miR-4680-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT378771 | MACC1 | MACC1, MET transcriptional regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT393867 | ZDHHC21 | zinc finger DHHC-type containing 21 | ![]() |
![]() |
2 | 4 | ||||||
MIRT446684 | C2CD2 | C2 calcium dependent domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT447600 | MRPL3 | mitochondrial ribosomal protein L3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450708 | RNF152 | ring finger protein 152 | ![]() |
![]() |
2 | 2 | ||||||
MIRT450784 | PAPOLG | poly(A) polymerase gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT454623 | COL23A1 | collagen type XXIII alpha 1 chain | ![]() |
![]() |
2 | 8 | ||||||
MIRT461620 | PTCD3 | pentatricopeptide repeat domain 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462695 | SNRPD3 | small nuclear ribonucleoprotein D3 polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT475530 | HOXA3 | homeobox A3 | ![]() |
![]() |
2 | 8 | ||||||
MIRT475739 | HERPUD1 | homocysteine inducible ER protein with ubiquitin like domain 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489676 | CYP1A1 | cytochrome P450 family 1 subfamily A member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490610 | SLC47A1 | solute carrier family 47 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493628 | HIC2 | HIC ZBTB transcriptional repressor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496152 | RPS15A | ribosomal protein S15a | ![]() |
![]() |
2 | 2 | ||||||
MIRT499232 | VAV3 | vav guanine nucleotide exchange factor 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT501496 | PRICKLE2 | prickle planar cell polarity protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT507163 | GAS2L3 | growth arrest specific 2 like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512389 | MTRNR2L1 | MT-RNR2-like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT514626 | MTRNR2L7 | MT-RNR2-like 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517474 | PEX26 | peroxisomal biogenesis factor 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT525332 | CNGB1 | cyclic nucleotide gated channel beta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT526685 | BAK1 | BCL2 antagonist/killer 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527317 | CCR2 | C-C motif chemokine receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527608 | EYS | eyes shut homolog (Drosophila) | ![]() |
![]() |
2 | 2 | ||||||
MIRT528794 | RAB32 | RAB32, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT531048 | TIPARP | TCDD inducible poly(ADP-ribose) polymerase | ![]() |
![]() |
2 | 2 | ||||||
MIRT532254 | TBPL2 | TATA-box binding protein like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533801 | TMED7 | transmembrane p24 trafficking protein 7 | ![]() |
![]() |
2 | 4 | ||||||
MIRT535887 | MLEC | malectin | ![]() |
![]() |
2 | 2 | ||||||
MIRT540704 | PDPK1 | 3-phosphoinositide dependent protein kinase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT544645 | PHF8 | PHD finger protein 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT545760 | HS3ST1 | heparan sulfate-glucosamine 3-sulfotransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555310 | PPP2R5C | protein phosphatase 2 regulatory subunit B'gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT555877 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT559507 | ARID5B | AT-rich interaction domain 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT560448 | SLC30A7 | solute carrier family 30 member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561262 | ZIK1 | zinc finger protein interacting with K protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561795 | PAWR | pro-apoptotic WT1 regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT567007 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569298 | SURF6 | surfeit 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570606 | MTRNR2L11 | MT-RNR2-like 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572888 | ADCY2 | adenylate cyclase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573119 | ADAMTS18 | ADAM metallopeptidase with thrombospondin type 1 motif 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608332 | ZNF670 | zinc finger protein 670 | ![]() |
![]() |
2 | 6 | ||||||
MIRT614942 | KCNK5 | potassium two pore domain channel subfamily K member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615324 | ERN1 | endoplasmic reticulum to nucleus signaling 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618441 | ZNF800 | zinc finger protein 800 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620110 | HARBI1 | harbinger transposase derived 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626008 | ZNF517 | zinc finger protein 517 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626626 | SLC30A6 | solute carrier family 30 member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627842 | POU3F1 | POU class 3 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628386 | CACNB2 | calcium voltage-gated channel auxiliary subunit beta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629305 | PTPLAD2 | 3-hydroxyacyl-CoA dehydratase 4 | ![]() |
1 | 1 | |||||||
MIRT629864 | GATAD1 | GATA zinc finger domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630444 | IDE | insulin degrading enzyme | ![]() |
![]() |
2 | 2 | ||||||
MIRT631854 | PIGG | phosphatidylinositol glycan anchor biosynthesis class G | ![]() |
![]() |
2 | 2 | ||||||
MIRT633173 | AGO3 | argonaute 3, RISC catalytic component | ![]() |
![]() |
2 | 2 | ||||||
MIRT633477 | ZNF724P | zinc finger protein 724 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634395 | PLSCR1 | phospholipid scramblase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635538 | TRIM72 | tripartite motif containing 72 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635821 | OPA3 | OPA3, outer mitochondrial membrane lipid metabolism regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT636169 | TIMM8A | translocase of inner mitochondrial membrane 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT636797 | CYB5D1 | cytochrome b5 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637952 | IVD | isovaleryl-CoA dehydrogenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT645136 | HES2 | hes family bHLH transcription factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645667 | ADK | adenosine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT646148 | FLVCR1 | feline leukemia virus subgroup C cellular receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647004 | NCR3LG1 | natural killer cell cytotoxicity receptor 3 ligand 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648187 | C2orf68 | chromosome 2 open reading frame 68 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650090 | TERF2 | telomeric repeat binding factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650329 | RTN2 | reticulon 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654224 | RNF165 | ring finger protein 165 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654545 | RAB1A | RAB1A, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT656457 | MAPK14 | mitogen-activated protein kinase 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656828 | KLF8 | Kruppel like factor 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657112 | ITPRIPL2 | inositol 1,4,5-trisphosphate receptor interacting protein like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657930 | GATSL2 | cytosolic arginine sensor for mTORC1 subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659375 | CREG2 | cellular repressor of E1A stimulated genes 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659833 | CARHSP1 | calcium regulated heat stable protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662108 | LACTB | lactamase beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT662789 | TBC1D25 | TBC1 domain family member 25 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669501 | ARL3 | ADP ribosylation factor like GTPase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669759 | ZNF101 | zinc finger protein 101 | ![]() |
![]() |
2 | 4 | ||||||
MIRT669800 | GAN | gigaxonin | ![]() |
![]() |
2 | 2 | ||||||
MIRT670050 | RPP14 | ribonuclease P/MRP subunit p14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670299 | RBBP4 | RB binding protein 4, chromatin remodeling factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT670388 | EMP2 | epithelial membrane protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672862 | C22orf29 | retrotransposon Gag like 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672890 | FXN | frataxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT673210 | C10orf76 | chromosome 10 open reading frame 76 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674001 | KCNN3 | potassium calcium-activated channel subfamily N member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674163 | BLOC1S3 | biogenesis of lysosomal organelles complex 1 subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674502 | TIRAP | TIR domain containing adaptor protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT675470 | NUBPL | nucleotide binding protein like | ![]() |
![]() |
2 | 2 | ||||||
MIRT675671 | TMOD2 | tropomodulin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676006 | CRKL | CRK like proto-oncogene, adaptor protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT676074 | TIMM50 | translocase of inner mitochondrial membrane 50 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676386 | SEC24D | SEC24 homolog D, COPII coat complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT676764 | SNX2 | sorting nexin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676896 | GABPB1 | GA binding protein transcription factor beta subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT676978 | ZNF708 | zinc finger protein 708 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677236 | C15orf40 | chromosome 15 open reading frame 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT677369 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT677464 | PDLIM3 | PDZ and LIM domain 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678081 | EIF2A | eukaryotic translation initiation factor 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT678093 | ATCAY | ATCAY, caytaxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT678324 | FBLIM1 | filamin binding LIM protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678417 | ANKRD36 | ankyrin repeat domain 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678521 | ZNF347 | zinc finger protein 347 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678700 | TRIP11 | thyroid hormone receptor interactor 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT678829 | PDE6A | phosphodiesterase 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT679991 | RUNDC1 | RUN domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680751 | PSD4 | pleckstrin and Sec7 domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681249 | ZNF383 | zinc finger protein 383 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681422 | GTF3C6 | general transcription factor IIIC subunit 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681948 | SLC19A3 | solute carrier family 19 member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689278 | C5AR2 | complement component 5a receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690389 | PARP15 | poly(ADP-ribose) polymerase family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691845 | OSCAR | osteoclast associated, immunoglobulin-like receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT693863 | IYD | iodotyrosine deiodinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT696002 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701930 | MLLT1 | MLLT1, super elongation complex subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT702341 | KLHL7 | kelch like family member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703557 | FKBP14 | FK506 binding protein 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705033 | CACUL1 | CDK2 associated cullin domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706341 | STAC2 | SH3 and cysteine rich domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709671 | RGP1 | RGP1 homolog, RAB6A GEF complex partner 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711212 | EFHB | EF-hand domain family member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT718342 | PURA | purine rich element binding protein A | ![]() |
![]() |
2 | 2 | ||||||
MIRT722755 | SIRPB2 | signal regulatory protein beta 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723535 | NFATC2IP | nuclear factor of activated T-cells 2 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT724498 | BFAR | bifunctional apoptosis regulator | ![]() |
![]() |
2 | 2 |