pre-miRNA Information
pre-miRNA hsa-mir-873   
Genomic Coordinates chr9: 28888879 - 28888955
Synonyms MIRN873, hsa-mir-873, MIR873
Description Homo sapiens miR-873 stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-873-3p
Sequence 46| GGAGACUGAUGAGUUCCCGGGA |67
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760528397 3 dbSNP
rs773403294 9 dbSNP
rs1273846238 13 dbSNP
rs1339396073 15 dbSNP
rs1247999695 18 dbSNP
rs377380148 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PHF7   
Synonyms HSPC045, HSPC226, NYD-SP6
Description PHD finger protein 7
Transcript NM_016483   
Expression
Putative miRNA Targets on PHF7
3'UTR of PHF7
(miRNA target sites are highlighted)
>PHF7|NM_016483|3'UTR
   1 CACCTTCTGAGTAGCTGCTGTCCCACACAATAGGGTATGAAGCTGCGCTCCTCCATCGGGTTTGGGGAGGGAGCACTCTG
  81 GGACTGTGAGACAAGGAAGCAGGGCCAGCAGTGAGACTATGAGCCAAGCAAAGAGAAGTCTCAGTGGAGCATGAGGAGGG
 161 AGCAGTCCAGATGCCAACAAGGAAATGCGTTTATGGCTACAAGAGTGCCTCTGCTTTCTCCTCCTCTCCTCCCACCAAGG
 241 ATTCTTCCACCTTAATCTTGTTTTCATATGCCTCTTCTTACTTCACCCATGTTTGTTGTTATGCAAATAAAGGTTTTCTC
 321 TCCAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agggcccuugaguagUCAGAGg 5'
                         |||||| 
Target 5' agccaagcaaagagaAGTCTCa 3'
122 - 143 120.00 -10.60
2
miRNA  3' aggGCCCUUGAGUAGUCAGagg 5'
             :| |:|   | |||||   
Target 5' gcaTGAGGAGGGAGCAGTCcag 3'
149 - 170 107.00 -11.70
3
miRNA  3' agGGCCCUUGAGUAGUCAGAgg 5'
            ::|||:|   | || |||  
Target 5' gtTTGGGGAGGGAGCACTCTgg 3'
60 - 81 104.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30448847 5 COSMIC
COSN30480926 23 COSMIC
COSN30518520 25 COSMIC
COSN30464792 31 COSMIC
COSN9553763 40 COSMIC
COSN16493971 140 COSMIC
COSN15662390 296 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs369065947 5 dbSNP
rs780858384 12 dbSNP
rs745673625 18 dbSNP
rs769680987 19 dbSNP
rs779965953 21 dbSNP
rs1351226108 25 dbSNP
rs749304238 33 dbSNP
rs1292716001 35 dbSNP
rs768700885 36 dbSNP
rs774585767 38 dbSNP
rs370441654 39 dbSNP
rs772211858 40 dbSNP
rs1031072185 42 dbSNP
rs1328431085 46 dbSNP
rs773431844 47 dbSNP
rs760783173 48 dbSNP
rs1450071865 51 dbSNP
rs766799331 52 dbSNP
rs930668578 58 dbSNP
rs958388281 59 dbSNP
rs984069569 65 dbSNP
rs117864462 69 dbSNP
rs1200394918 79 dbSNP
rs564817013 81 dbSNP
rs944844261 86 dbSNP
rs1202053566 92 dbSNP
rs1040589064 93 dbSNP
rs142163556 94 dbSNP
rs1018433044 97 dbSNP
rs1244593215 104 dbSNP
rs151202591 105 dbSNP
rs1313586732 108 dbSNP
rs964182444 110 dbSNP
rs1374565277 118 dbSNP
rs181467925 119 dbSNP
rs931759496 128 dbSNP
rs369376672 130 dbSNP
rs1351830441 134 dbSNP
rs113466954 142 dbSNP
rs1424114092 145 dbSNP
rs892756695 146 dbSNP
rs1209197830 149 dbSNP
rs111637197 155 dbSNP
rs780197759 162 dbSNP
rs1267704513 165 dbSNP
rs1453126484 166 dbSNP
rs1249616216 167 dbSNP
rs922857846 170 dbSNP
rs543547740 173 dbSNP
rs1179219524 180 dbSNP
rs1292054479 186 dbSNP
rs1221198741 188 dbSNP
rs747109475 189 dbSNP
rs932988396 190 dbSNP
rs768729849 194 dbSNP
rs983543346 200 dbSNP
rs190071702 201 dbSNP
rs182175942 204 dbSNP
rs563811631 208 dbSNP
rs1318037560 211 dbSNP
rs941792803 214 dbSNP
rs1390035017 224 dbSNP
rs1034183520 235 dbSNP
rs1304006308 238 dbSNP
rs1404524856 241 dbSNP
rs1415067734 252 dbSNP
rs878970676 267 dbSNP
rs991276253 272 dbSNP
rs894942865 278 dbSNP
rs1391894561 289 dbSNP
rs947889323 290 dbSNP
rs1434697977 297 dbSNP
rs1046285281 299 dbSNP
rs1269286380 301 dbSNP
rs906473849 303 dbSNP
rs983480630 308 dbSNP
rs1327059873 316 dbSNP
rs908106440 317 dbSNP
rs1350151474 319 dbSNP
rs1349255020 325 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' agggcccuugaguagUCAGAGg 5'
                         |||||| 
Target 5' ---------agagggAGUCUCa 3'
1 - 13
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_ControlA_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control A
Location of target site ENST00000327906.3 | 3UTR | GAGAGGGAGUCUCACUCUGUUGCCCAGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset Chi_ControlB_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control B
Location of target site ENST00000327906.3 | 3UTR | AGAGGGAGUCUCACUCUGUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-873-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT081178 MIDN midnolin 2 4
MIRT109809 ZFX zinc finger protein, X-linked 2 4
MIRT242383 TMC5 transmembrane channel like 5 2 4
MIRT444003 METRN meteorin, glial cell differentiation regulator 2 4
MIRT444097 SEPHS1 selenophosphate synthetase 1 2 2
MIRT446158 RPL12 ribosomal protein L12 2 2
MIRT446859 SAMD9L sterile alpha motif domain containing 9 like 2 2
MIRT447275 FZD5 frizzled class receptor 5 2 2
MIRT447391 TMPRSS15 transmembrane protease, serine 15 2 2
MIRT448817 FKBP1A FK506 binding protein 1A 2 4
MIRT450582 HIST1H2BG histone cluster 1 H2B family member g 2 2
MIRT451776 USP36 ubiquitin specific peptidase 36 2 2
MIRT457961 ABCC5 ATP binding cassette subfamily C member 5 2 4
MIRT458424 KLHL38 kelch like family member 38 2 4
MIRT461383 SLFN12L schlafen family member 12 like 2 2
MIRT467793 SLC2A14 solute carrier family 2 member 14 2 2
MIRT476517 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT480290 C7orf73 short transmembrane mitochondrial protein 1 2 4
MIRT482745 HES7 hes family bHLH transcription factor 7 2 10
MIRT483189 HIST1H2AH histone cluster 1 H2A family member h 2 6
MIRT486545 DCTN4 dynactin subunit 4 2 2
MIRT486581 ZNF619 zinc finger protein 619 2 2
MIRT492604 POLR3E RNA polymerase III subunit E 2 2
MIRT494130 DCAF7 DDB1 and CUL4 associated factor 7 2 6
MIRT496023 ZBED3 zinc finger BED-type containing 3 2 2
MIRT497121 NBEAL1 neurobeachin like 1 2 2
MIRT497400 TMEM245 transmembrane protein 245 2 2
MIRT501410 RANBP10 RAN binding protein 10 2 2
MIRT510947 PPTC7 PTC7 protein phosphatase homolog 2 6
MIRT512494 ARID2 AT-rich interaction domain 2 2 2
MIRT512595 ZNF783 zinc finger family member 783 2 2
MIRT512612 CNTN4 contactin 4 2 2
MIRT517808 UGDH UDP-glucose 6-dehydrogenase 2 6
MIRT520686 TMED7 transmembrane p24 trafficking protein 7 2 4
MIRT526179 HEPH hephaestin 2 2
MIRT532568 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT533979 TADA2A transcriptional adaptor 2A 2 2
MIRT538622 CCSER2 coiled-coil serine rich protein 2 2 4
MIRT539703 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT539806 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT540422 FAM83F family with sequence similarity 83 member F 2 2
MIRT540506 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT540619 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT542423 ZNF331 zinc finger protein 331 2 2
MIRT542454 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT543383 CC2D2A coiled-coil and C2 domain containing 2A 2 2
MIRT544777 CSTF2T cleavage stimulation factor subunit 2 tau variant 2 4
MIRT544923 ERCC4 ERCC excision repair 4, endonuclease catalytic subunit 2 2
MIRT549768 ZNF611 zinc finger protein 611 2 4
MIRT551242 COLEC10 collectin subfamily member 10 2 2
MIRT560474 ENSA endosulfine alpha 2 2
MIRT569738 GPR173 G protein-coupled receptor 173 2 2
MIRT571297 CHCHD4 coiled-coil-helix-coiled-coil-helix domain containing 4 2 2
MIRT572345 CKAP2L cytoskeleton associated protein 2 like 2 2
MIRT573112 ERBB2IP erbb2 interacting protein 2 2
MIRT607744 ANGPT4 angiopoietin 4 2 2
MIRT607903 SPRYD4 SPRY domain containing 4 2 2
MIRT611744 SERPING1 serpin family G member 1 2 4
MIRT615101 BNC2 basonuclin 2 2 2
MIRT619124 CD40LG CD40 ligand 2 2
MIRT625572 ANKRD42 ankyrin repeat domain 42 2 2
MIRT629038 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT633986 SLC35E2 solute carrier family 35 member E2 2 2
MIRT635675 COX18 COX18, cytochrome c oxidase assembly factor 2 4
MIRT637471 DEFB105B defensin beta 105B 2 4
MIRT637503 DEFB105A defensin beta 105A 2 4
MIRT639735 MAP2K2 mitogen-activated protein kinase kinase 2 2 2
MIRT640730 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT645364 C9orf47 chromosome 9 open reading frame 47 2 2
MIRT647938 RNF152 ring finger protein 152 2 2
MIRT649400 SH2D4A SH2 domain containing 4A 2 2
MIRT656860 KIN Kin17 DNA and RNA binding protein 2 2
MIRT663470 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT663507 NKAPL NFKB activating protein like 2 4
MIRT667690 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT677403 PCNP PEST proteolytic signal containing nuclear protein 2 2
MIRT678682 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT678789 NUPL2 nucleoporin like 2 2 2
MIRT680649 KIAA1456 KIAA1456 2 2
MIRT682450 MTX3 metaxin 3 2 2
MIRT682740 CA6 carbonic anhydrase 6 2 2
MIRT684421 TUFT1 tuftelin 1 2 2
MIRT690535 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT690595 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT690771 PLA2G2C phospholipase A2 group IIC 2 2
MIRT692233 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT693667 MXRA7 matrix remodeling associated 7 2 2
MIRT695551 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT695870 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT696214 LYZ lysozyme 2 2
MIRT698368 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT700795 PHTF2 putative homeodomain transcription factor 2 2 2
MIRT701640 MYLK3 myosin light chain kinase 3 2 2
MIRT702989 HERPUD2 HERPUD family member 2 2 2
MIRT703627 FBXL3 F-box and leucine rich repeat protein 3 2 2
MIRT703783 FAM102B family with sequence similarity 102 member B 2 2
MIRT704293 DDX19B DEAD-box helicase 19B 2 2
MIRT704828 CDC73 cell division cycle 73 2 2
MIRT705014 CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 2 2
MIRT708480 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT710770 PHF7 PHD finger protein 7 2 2
MIRT718918 TRIM66 tripartite motif containing 66 2 2
MIRT720390 ZNF549 zinc finger protein 549 2 2
MIRT720593 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT723515 SIGLEC8 sialic acid binding Ig like lectin 8 2 2
MIRT724458 PRKX protein kinase, X-linked 2 2
MIRT737267 UMAD1 UBAP1-MVB12-associated (UMA) domain containing 1 3 0
MIRT737356 ZIC2 Zic family member 2 4 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-873 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-873 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-873 Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-873 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-873 Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-873-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-873-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-873-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-873-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-873-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission