pre-miRNA Information
pre-miRNA hsa-mir-452   
Genomic Coordinates chrX: 151959628 - 151959712
Synonyms MIRN452, hsa-mir-452, MIR452
Description Homo sapiens miR-452 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-452-3p
Sequence 58| CUCAUCUGCAAAGAAGUAAGUG |79
Evidence Experimental
Experiments Array-cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 X - 151959644 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs757928550 3 dbSNP
rs1324216965 6 dbSNP
rs1390793899 13 dbSNP
rs899383242 17 dbSNP
rs747858567 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PARL   
Synonyms PRO2207, PSARL, PSARL1, PSENIP2, RHBDS1
Description presenilin associated rhomboid like
Transcript NM_001037639   
Other Transcripts NM_018622   
Expression
Putative miRNA Targets on PARL
3'UTR of PARL
(miRNA target sites are highlighted)
>PARL|NM_001037639|3'UTR
   1 AACTGGGATTGGACAGTAGTGGTGCATCTGGTCCTTGCCGCCTGAGAGCCCCAGGAGACATCGGCTAGAGTGACCATGGC
  81 TATGCTCCCGTCTGGAAGATGCCAGCATCTGGCCTCCCACTGTTTTCAGCTGTGTCCCCCAGTCCGTGTCTTTTTAGAAT
 161 GTGAATGATGATAAAGTTGTGAAATAAAGGTTTCTATCTAGTTTGTAAGCAGAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gugaaUGAAGAAACGUCUACuc 5'
               ||| :||| ||| ||  
Target 5' ctcccACTGTTTT-CAGCTGtg 3'
114 - 134 108.00 -7.40
2
miRNA  3' guGAAUGAAGAAACGUCUACuc 5'
            ||  | || | | |||||  
Target 5' tgCTCCCGTC-TGGAAGATGcc 3'
83 - 103 103.00 -6.90
3
miRNA  3' gugaAUGAAGAAACGUCUACUc 5'
              |: | |||  |:  ||| 
Target 5' catcTGGTCCTTGCCGCCTGAg 3'
25 - 46 74.00 -6.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30511230 25 COSMIC
COSN32053242 28 COSMIC
COSN26573944 38 COSMIC
COSN30482174 42 COSMIC
COSN14050273 51 COSMIC
COSN31496992 71 COSMIC
COSN30512171 85 COSMIC
COSN30523028 89 COSMIC
COSN17675137 94 COSMIC
COSN31491351 137 COSMIC
COSN31500906 146 COSMIC
COSN31512198 157 COSMIC
COSN31525936 157 COSMIC
COSN31611967 202 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1383986629 5 dbSNP
rs34050687 8 dbSNP
rs1181017744 13 dbSNP
rs1258893465 14 dbSNP
rs988790999 22 dbSNP
rs780979373 24 dbSNP
rs1320306725 26 dbSNP
rs1180055501 30 dbSNP
rs754728610 31 dbSNP
rs766401444 34 dbSNP
rs1208781642 37 dbSNP
rs763027946 39 dbSNP
rs371236566 40 dbSNP
rs376335908 42 dbSNP
rs1352835927 46 dbSNP
rs9650 48 dbSNP
rs780581786 62 dbSNP
rs192478892 63 dbSNP
rs187799940 67 dbSNP
rs1349651858 70 dbSNP
rs1437717324 77 dbSNP
rs953499872 80 dbSNP
rs1030583755 82 dbSNP
rs758966666 87 dbSNP
rs548057248 88 dbSNP
rs1278954460 89 dbSNP
rs1320150218 90 dbSNP
rs762422052 99 dbSNP
rs1014447981 103 dbSNP
rs1289512706 107 dbSNP
rs1320818555 107 dbSNP
rs998139733 111 dbSNP
rs530050876 114 dbSNP
rs962102379 116 dbSNP
rs1487285716 122 dbSNP
rs1192904795 126 dbSNP
rs1047909546 131 dbSNP
rs1480825714 136 dbSNP
rs1179752303 137 dbSNP
rs1246319767 145 dbSNP
rs993174364 146 dbSNP
rs1406262796 153 dbSNP
rs115348507 159 dbSNP
rs1359148029 160 dbSNP
rs887849002 161 dbSNP
rs1055778837 163 dbSNP
rs1342443668 165 dbSNP
rs1445915976 170 dbSNP
rs1037663678 180 dbSNP
rs943260798 196 dbSNP
rs1262784482 198 dbSNP
rs35712161 198 dbSNP
rs1380191227 207 dbSNP
rs1228632567 209 dbSNP
rs1316852667 214 dbSNP
rs1208509962 217 dbSNP
rs540627947 221 dbSNP
rs1327683632 222 dbSNP
rs910408497 223 dbSNP
rs1051587974 226 dbSNP
rs933125491 238 dbSNP
rs528444676 239 dbSNP
rs904986070 240 dbSNP
rs142112852 244 dbSNP
rs988822021 245 dbSNP
rs956042485 249 dbSNP
rs1159708236 263 dbSNP
rs925951655 267 dbSNP
rs1412781238 276 dbSNP
rs137977056 287 dbSNP
rs1359858561 293 dbSNP
rs1326663922 294 dbSNP
rs376264917 298 dbSNP
rs1307418336 301 dbSNP
rs1374380880 310 dbSNP
rs1023577287 314 dbSNP
rs575795269 320 dbSNP
rs373905312 327 dbSNP
rs1309815994 328 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + A
Location of target site ENST00000317096.4 | 3UTR | AGAUGAGGCAAGAUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset Chi_124B_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + B
Location of target site ENST00000317096.4 | 3UTR | AGAUGAGGCAAGAUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset Chi_ControlA_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control A
Location of target site ENST00000317096.4 | 3UTR | AGAUGAGGCAAGAUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset Chi_ControlB_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control B
Location of target site ENST00000317096.4 | 3UTR | AGAUGAGGCAAGAUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38974 Chronic obstructive pulmonary disease -0.673 1.1e-4 -0.615 5.3e-4 25 Click to see details
GSE28544 Breast cancer 0.465 1.1e-2 0.518 4.8e-3 24 Click to see details
GSE17306 Multiple myeloma -0.3 1.8e-2 0.410 1.7e-3 49 Click to see details
GSE32688 Pancreatic cancer 0.246 8.7e-2 0.237 9.6e-2 32 Click to see details
GSE38226 Liver fibrosis 0.254 1.3e-1 0.281 1.1e-1 21 Click to see details
GSE21687 Ependynoma primary tumors -0.059 3.2e-1 -0.052 3.4e-1 64 Click to see details
GSE28260 Renal cortex and medulla -0.13 3.4e-1 0.203 2.5e-1 13 Click to see details
GSE17498 Multiple myeloma -0.064 3.5e-1 0.031 4.2e-1 40 Click to see details
GSE19350 CNS germ cell tumors 0.121 3.5e-1 0.490 5.3e-2 12 Click to see details
GSE26953 Aortic valvular endothelial cells 0.08 3.6e-1 -0.225 1.5e-1 24 Click to see details
GSE21849 B cell lymphoma -0.058 3.8e-1 0.061 3.8e-1 29 Click to see details
GSE42095 Differentiated embryonic stem cells -0.064 3.9e-1 -0.031 4.4e-1 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.065 3.9e-1 -0.113 3.2e-1 20 Click to see details
GSE27834 Pluripotent stem cells -0.056 4.2e-1 -0.218 2.1e-1 16 Click to see details
GSE14794 Lymphoblastoid cells 0.013 4.5e-1 0.067 2.7e-1 90 Click to see details
GSE14794 Lymphoblastoid cells 0.013 4.5e-1 0.067 2.7e-1 90 Click to see details
GSE14794 Lymphoblastoid cells 0.013 4.5e-1 0.067 2.7e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUSC 0.526 0 0.493 0 38 Click to see details
BRCA 0.317 0 0.339 0 79 Click to see details
KIRC 0.326 0 0.294 0.01 65 Click to see details
UCEC 0.377 0.06 0.311 0.1 19 Click to see details
LIHC 0.191 0.09 0.227 0.06 49 Click to see details
CESC 0.952 0.1 1.000 0.5 3 Click to see details
STAD -0.212 0.13 -0.167 0.19 29 Click to see details
KIRP -0.19 0.15 -0.141 0.22 31 Click to see details
HNSC -0.135 0.2 -0.137 0.19 42 Click to see details
KICH -0.168 0.22 -0.051 0.41 24 Click to see details
ESCA 0.3 0.22 0.383 0.15 9 Click to see details
PAAD 0.559 0.22 0.400 0.3 4 Click to see details
THCA 0.097 0.23 0.125 0.17 59 Click to see details
BLCA -0.113 0.33 -0.123 0.32 17 Click to see details
LUAD 0.124 0.36 0.109 0.37 11 Click to see details
CHOL -0.124 0.38 -0.283 0.23 9 Click to see details
PRAD -0.021 0.44 -0.042 0.39 48 Click to see details
PRAD -0.021 0.44 -0.042 0.39 48 Click to see details
PRAD -0.021 0.44 -0.042 0.39 48 Click to see details
PRAD -0.021 0.44 -0.042 0.39 48 Click to see details
87 hsa-miR-452-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT150000 MIDN midnolin 2 10
MIRT330600 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT358701 SUB1 SUB1 homolog, transcriptional regulator 2 4
MIRT362854 EIF4H eukaryotic translation initiation factor 4H 2 2
MIRT447215 ATXN7 ataxin 7 2 2
MIRT466655 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 6
MIRT483979 PANK1 pantothenate kinase 1 2 8
MIRT485118 SF3B3 splicing factor 3b subunit 3 2 2
MIRT488864 AUTS8 Autism, susceptibility to, 8 2 2
MIRT492293 SH2B3 SH2B adaptor protein 3 2 2
MIRT492976 NCK2 NCK adaptor protein 2 2 2
MIRT497410 LRRC40 leucine rich repeat containing 40 2 2
MIRT511143 MRPL17 mitochondrial ribosomal protein L17 2 6
MIRT512650 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT513017 NSFL1C NSFL1 cofactor 2 6
MIRT520445 TSPAN2 tetraspanin 2 2 6
MIRT527995 NDNF neuron derived neurotrophic factor 2 2
MIRT528667 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT533512 TRIM71 tripartite motif containing 71 2 2
MIRT537404 FBXO47 F-box protein 47 2 2
MIRT538161 DCP2 decapping mRNA 2 2 2
MIRT539124 ARHGEF17 Rho guanine nucleotide exchange factor 17 2 2
MIRT540666 MIS18A MIS18 kinetochore protein A 2 4
MIRT542948 GDF11 growth differentiation factor 11 2 2
MIRT547534 MAML3 mastermind like transcriptional coactivator 3 2 2
MIRT559033 C20orf24 chromosome 20 open reading frame 24 2 4
MIRT559554 ARF6 ADP ribosylation factor 6 2 2
MIRT570177 RCBTB1 RCC1 and BTB domain containing protein 1 2 2
MIRT573149 ITGA9 integrin subunit alpha 9 2 2
MIRT575849 Rab1 RAB1A, member RAS oncogene family 1 1
MIRT611034 RRP1B ribosomal RNA processing 1B 2 2
MIRT616281 HMGB1 high mobility group box 1 2 2
MIRT618372 PRKG2 protein kinase, cGMP-dependent, type II 2 2
MIRT619540 PIWIL2 piwi like RNA-mediated gene silencing 2 2 2
MIRT622303 SGIP1 SH3 domain GRB2 like endophilin interacting protein 1 2 2
MIRT622590 PRRG4 proline rich and Gla domain 4 2 2
MIRT624441 CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 2 2
MIRT637089 KLRD1 killer cell lectin like receptor D1 2 2
MIRT639084 ADCYAP1 adenylate cyclase activating polypeptide 1 2 2
MIRT639334 NINJ1 ninjurin 1 2 2
MIRT639798 EIF3E eukaryotic translation initiation factor 3 subunit E 2 2
MIRT640851 RAB3B RAB3B, member RAS oncogene family 2 2
MIRT641628 KIAA1244 ARFGEF family member 3 1 1
MIRT642634 EPPIN epididymal peptidase inhibitor 2 2
MIRT643053 EPPIN-WFDC6 EPPIN-WFDC6 readthrough 2 2
MIRT643416 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT645586 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT647393 FAM181B family with sequence similarity 181 member B 2 2
MIRT649411 CDC14B cell division cycle 14B 2 2
MIRT649477 CLDN16 claudin 16 2 2
MIRT651307 ZDHHC20 zinc finger DHHC-type containing 20 2 2
MIRT651387 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT653411 SLC7A2 solute carrier family 7 member 2 2 2
MIRT654084 RSPH4A radial spoke head 4 homolog A 2 2
MIRT654613 PTPRM protein tyrosine phosphatase, receptor type M 2 2
MIRT655338 PCP4L1 Purkinje cell protein 4 like 1 2 2
MIRT656173 MRPL44 mitochondrial ribosomal protein L44 2 2
MIRT657272 HS3ST3B1 heparan sulfate-glucosamine 3-sulfotransferase 3B1 2 2
MIRT657881 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 2
MIRT659875 CAPRIN1 cell cycle associated protein 1 2 2
MIRT662381 ICA1L islet cell autoantigen 1 like 2 4
MIRT666308 SLC22A3 solute carrier family 22 member 3 2 2
MIRT667274 NAV1 neuron navigator 1 2 2
MIRT667614 LIMCH1 LIM and calponin homology domains 1 2 2
MIRT674242 NUP62 nucleoporin 62 2 4
MIRT690386 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT693402 NUDT16 nudix hydrolase 16 2 2
MIRT702503 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT708632 STMN4 stathmin 4 2 2
MIRT708839 SCAND3 zinc finger BED-type containing 9 1 1
MIRT709016 HSBP1 heat shock factor binding protein 1 2 2
MIRT709235 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT710885 PARL presenilin associated rhomboid like 2 2
MIRT712262 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT712573 ATP2B4 ATPase plasma membrane Ca2+ transporting 4 2 2
MIRT715046 PRPF38A pre-mRNA processing factor 38A 2 2
MIRT718905 GALR1 galanin receptor 1 2 2
MIRT719368 FEM1A fem-1 homolog A 2 2
MIRT719495 SEC24B SEC24 homolog B, COPII coat complex component 2 2
MIRT719601 PRKX protein kinase, X-linked 2 2
MIRT719891 RRP36 ribosomal RNA processing 36 2 2
MIRT720063 ZNF449 zinc finger protein 449 2 2
MIRT721679 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT721724 VTI1A vesicle transport through interaction with t-SNAREs 1A 2 2
MIRT723370 ZNF470 zinc finger protein 470 2 2
MIRT724941 TXNL1 thioredoxin like 1 2 2
MIRT725302 NLRC5 NLR family CARD domain containing 5 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-452 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-452 Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-452 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 down-regulated
miR-452 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-mir-452 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-452-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-452-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-452-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-452-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (HCT8)
hsa-miR-452-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-452-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-452-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-452-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-452-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-452-3p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission