pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-452 |
Genomic Coordinates | chrX: 151959628 - 151959712 |
Synonyms | MIRN452, hsa-mir-452, MIR452 |
Description | Homo sapiens miR-452 stem-loop |
Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations. |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-452-3p | ||||||||||||||||||
Sequence | 58| CUCAUCUGCAAAGAAGUAAGUG |79 | ||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||
Experiments | Array-cloned | ||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | PARL | ||||||||||||||||||||
Synonyms | PRO2207, PSARL, PSARL1, PSENIP2, RHBDS1 | ||||||||||||||||||||
Description | presenilin associated rhomboid like | ||||||||||||||||||||
Transcript | NM_001037639 | ||||||||||||||||||||
Other Transcripts | NM_018622 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on PARL | |||||||||||||||||||||
3'UTR of PARL (miRNA target sites are highlighted) |
>PARL|NM_001037639|3'UTR 1 AACTGGGATTGGACAGTAGTGGTGCATCTGGTCCTTGCCGCCTGAGAGCCCCAGGAGACATCGGCTAGAGTGACCATGGC 81 TATGCTCCCGTCTGGAAGATGCCAGCATCTGGCCTCCCACTGTTTTCAGCTGTGTCCCCCAGTCCGTGTCTTTTTAGAAT 161 GTGAATGATGATAAAGTTGTGAAATAAAGGTTTCTATCTAGTTTGTAAGCAGAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HeLa |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A
HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B
HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A
HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + A |
Location of target site | ENST00000317096.4 | 3UTR | AGAUGAGGCAAGAUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset Chi_124B_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + B |
Location of target site | ENST00000317096.4 | 3UTR | AGAUGAGGCAAGAUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset Chi_ControlA_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell Control A |
Location of target site | ENST00000317096.4 | 3UTR | AGAUGAGGCAAGAUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset Chi_ControlB_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell Control B |
Location of target site | ENST00000317096.4 | 3UTR | AGAUGAGGCAAGAUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
87 hsa-miR-452-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT150000 | MIDN | midnolin | ![]() |
![]() |
2 | 10 | ||||||
MIRT330600 | ZWINT | ZW10 interacting kinetochore protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT358701 | SUB1 | SUB1 homolog, transcriptional regulator | ![]() |
![]() |
2 | 4 | ||||||
MIRT362854 | EIF4H | eukaryotic translation initiation factor 4H | ![]() |
![]() |
2 | 2 | ||||||
MIRT447215 | ATXN7 | ataxin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466655 | TAF1D | TATA-box binding protein associated factor, RNA polymerase I subunit D | ![]() |
![]() |
2 | 6 | ||||||
MIRT483979 | PANK1 | pantothenate kinase 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT485118 | SF3B3 | splicing factor 3b subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT488864 | AUTS8 | Autism, susceptibility to, 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492293 | SH2B3 | SH2B adaptor protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492976 | NCK2 | NCK adaptor protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497410 | LRRC40 | leucine rich repeat containing 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT511143 | MRPL17 | mitochondrial ribosomal protein L17 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512650 | MAP3K2 | mitogen-activated protein kinase kinase kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT513017 | NSFL1C | NSFL1 cofactor | ![]() |
![]() |
2 | 6 | ||||||
MIRT520445 | TSPAN2 | tetraspanin 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT527995 | NDNF | neuron derived neurotrophic factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT528667 | PDE4DIP | phosphodiesterase 4D interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT533512 | TRIM71 | tripartite motif containing 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT537404 | FBXO47 | F-box protein 47 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538161 | DCP2 | decapping mRNA 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539124 | ARHGEF17 | Rho guanine nucleotide exchange factor 17 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540666 | MIS18A | MIS18 kinetochore protein A | ![]() |
![]() |
2 | 4 | ||||||
MIRT542948 | GDF11 | growth differentiation factor 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547534 | MAML3 | mastermind like transcriptional coactivator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559033 | C20orf24 | chromosome 20 open reading frame 24 | ![]() |
![]() |
2 | 4 | ||||||
MIRT559554 | ARF6 | ADP ribosylation factor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570177 | RCBTB1 | RCC1 and BTB domain containing protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573149 | ITGA9 | integrin subunit alpha 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575849 | Rab1 | RAB1A, member RAS oncogene family | ![]() |
1 | 1 | |||||||
MIRT611034 | RRP1B | ribosomal RNA processing 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT616281 | HMGB1 | high mobility group box 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618372 | PRKG2 | protein kinase, cGMP-dependent, type II | ![]() |
![]() |
2 | 2 | ||||||
MIRT619540 | PIWIL2 | piwi like RNA-mediated gene silencing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622303 | SGIP1 | SH3 domain GRB2 like endophilin interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622590 | PRRG4 | proline rich and Gla domain 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624441 | CAMK2N1 | calcium/calmodulin dependent protein kinase II inhibitor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637089 | KLRD1 | killer cell lectin like receptor D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639084 | ADCYAP1 | adenylate cyclase activating polypeptide 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639334 | NINJ1 | ninjurin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639798 | EIF3E | eukaryotic translation initiation factor 3 subunit E | ![]() |
![]() |
2 | 2 | ||||||
MIRT640851 | RAB3B | RAB3B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT641628 | KIAA1244 | ARFGEF family member 3 | ![]() |
1 | 1 | |||||||
MIRT642634 | EPPIN | epididymal peptidase inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT643053 | EPPIN-WFDC6 | EPPIN-WFDC6 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT643416 | ERVMER34-1 | endogenous retrovirus group MER34 member 1, envelope | ![]() |
![]() |
2 | 2 | ||||||
MIRT645586 | SAR1A | secretion associated Ras related GTPase 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT647393 | FAM181B | family with sequence similarity 181 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT649411 | CDC14B | cell division cycle 14B | ![]() |
![]() |
2 | 2 | ||||||
MIRT649477 | CLDN16 | claudin 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651307 | ZDHHC20 | zinc finger DHHC-type containing 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651387 | ZBTB16 | zinc finger and BTB domain containing 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653411 | SLC7A2 | solute carrier family 7 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654084 | RSPH4A | radial spoke head 4 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT654613 | PTPRM | protein tyrosine phosphatase, receptor type M | ![]() |
![]() |
2 | 2 | ||||||
MIRT655338 | PCP4L1 | Purkinje cell protein 4 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT656173 | MRPL44 | mitochondrial ribosomal protein L44 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657272 | HS3ST3B1 | heparan sulfate-glucosamine 3-sulfotransferase 3B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657881 | GFPT1 | glutamine--fructose-6-phosphate transaminase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659875 | CAPRIN1 | cell cycle associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662381 | ICA1L | islet cell autoantigen 1 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT666308 | SLC22A3 | solute carrier family 22 member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT667274 | NAV1 | neuron navigator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT667614 | LIMCH1 | LIM and calponin homology domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674242 | NUP62 | nucleoporin 62 | ![]() |
![]() |
2 | 4 | ||||||
MIRT690386 | PARP15 | poly(ADP-ribose) polymerase family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693402 | NUDT16 | nudix hydrolase 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT702503 | KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708632 | STMN4 | stathmin 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708839 | SCAND3 | zinc finger BED-type containing 9 | ![]() |
1 | 1 | |||||||
MIRT709016 | HSBP1 | heat shock factor binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709235 | RANGAP1 | Ran GTPase activating protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710885 | PARL | presenilin associated rhomboid like | ![]() |
![]() |
2 | 2 | ||||||
MIRT712262 | PPP1CB | protein phosphatase 1 catalytic subunit beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT712573 | ATP2B4 | ATPase plasma membrane Ca2+ transporting 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715046 | PRPF38A | pre-mRNA processing factor 38A | ![]() |
![]() |
2 | 2 | ||||||
MIRT718905 | GALR1 | galanin receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719368 | FEM1A | fem-1 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT719495 | SEC24B | SEC24 homolog B, COPII coat complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT719601 | PRKX | protein kinase, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT719891 | RRP36 | ribosomal RNA processing 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720063 | ZNF449 | zinc finger protein 449 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721679 | CMTM4 | CKLF like MARVEL transmembrane domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721724 | VTI1A | vesicle transport through interaction with t-SNAREs 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT723370 | ZNF470 | zinc finger protein 470 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724941 | TXNL1 | thioredoxin like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725302 | NLRC5 | NLR family CARD domain containing 5 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|