miRTarBase - #MIRT710945


—
pre-miRNA Information
pre-miRNA hsa-mir-500b   
Genomic Coordinates chrX: 50010672 - 50010750
Description Homo sapiens miR-500b stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-500b-3p
Sequence 51| GCACCCAGGCAAGGAUUCUG |70
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs782140253 8 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MRPL45   
Synonyms L45mt, MRP-L45
Description mitochondrial ribosomal protein L45
Transcript NM_032351   
Expression
Putative miRNA Targets on MRPL45
3'UTR of MRPL45
(miRNA target sites are highlighted)		 
>MRPL45|NM_032351|3'UTR
   1 TGACAAAAATGACTTCTAGGGTGAAGCCTGGGTGATGAGGCTGCTGGAAGCTTTGAAGTCTCCCATTCCCCTCATGCTAT
  81 AAAAAGAACTACCTTTGTTCTCTCCCATCCTGCTCAGGTCTTTTCAGCAGTCTCATCATCAGCAACCATGACTGATGACT
 161 GGGCCCTAGCAGGTGGCAGGTATAACATGGCCATGGACACTCTTCTTTTTTAAATTTTATGTCTAGCTTCTGAGTCTAGA
 241 TGAAAGACAGTATGTTTCAGAGAACATTGGATATCAGTTTTTCCCACAGCAGGGACTGTGAGAGACAACCAGCAGCATCC
 321 TCTTTGTAATCACAGGGCAGGGATCAGAGTTTGAAATGAAATGTTGTCAGGGTGTTGGAAAAATTTTGGTGAGTTCTGCA
 401 CATTTCCCCTGGTTCAGGCTGGGCATGGACCAGCCTTCAGATGGCAGAAGTGGAAGATGAGCCTACTTGTGAGCGATGTG
 481 ACTTTAAGGAAATGAAGACTGGGGAAGAATAATTAGTGTTTATAAGACATTTAAGAGGCCCTTTTTCATATACTGACTCA
 561 CTGATGAATCAGCATTTGCATTTTATGGAAAAATATAAATCCAAAGAAATAATTTATCCCTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guCUUAGGA----A---CGGACCCACg 5'
            || |:||    |   ||||||||| 
Target 5' atGACTTCTAGGGTGAAGCCTGGGTGa 3'
 9 - 35 152.00 -20.60
2 
miRNA  3' guCUUAGGAACGGACCCACg 5'
            ||| : |||:| ||||| 
Target 5' atGAAATGTTGTCAGGGTGt 3'
 356 - 375 134.00 -14.90
3 
miRNA  3' gucuuaggaACGGACCCacg 5'
                   || |||||   
Target 5' catgactgaTGACTGGGccc 3'
 147 - 166 107.00 -8.60
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs200734868 1 dbSNP
rs760585576 3 dbSNP
rs766154498 9 dbSNP
rs753669889 13 dbSNP
rs373033177 18 dbSNP
rs935752677 24 dbSNP
rs369593896 26 dbSNP
rs1165304817 27 dbSNP
rs752326050 29 dbSNP
rs539916887 35 dbSNP
rs559859866 38 dbSNP
rs780447318 43 dbSNP
rs1412989953 51 dbSNP
rs1238352098 61 dbSNP
rs750268773 68 dbSNP
rs1476124500 72 dbSNP
rs758183868 78 dbSNP
rs531969228 81 dbSNP
rs1192272133 89 dbSNP
rs1487137513 89 dbSNP
rs1270587928 94 dbSNP
rs940690768 117 dbSNP
rs796256520 122 dbSNP
rs1322638367 135 dbSNP
rs1289822391 138 dbSNP
rs766191288 142 dbSNP
rs1227066043 147 dbSNP
rs1320587836 150 dbSNP
rs551844624 157 dbSNP
rs891566495 159 dbSNP
rs1294991622 173 dbSNP
rs1338713483 181 dbSNP
rs1393828666 187 dbSNP
rs1295443354 188 dbSNP
rs1436956042 199 dbSNP
rs12094 203 dbSNP
rs10568 206 dbSNP
rs1349046424 213 dbSNP
rs1479275407 219 dbSNP
rs1321301552 221 dbSNP
rs907313968 231 dbSNP
rs938729713 240 dbSNP
rs1408489771 242 dbSNP
rs1055865001 250 dbSNP
rs933798964 253 dbSNP
rs186947847 265 dbSNP
rs191016452 268 dbSNP
rs1007250193 290 dbSNP
rs1246533895 292 dbSNP
rs1219798400 298 dbSNP
rs1459526903 321 dbSNP
rs1022295371 323 dbSNP
rs1323949917 325 dbSNP
rs1218102226 326 dbSNP
rs1332802690 337 dbSNP
rs1233875516 346 dbSNP
rs903432179 348 dbSNP
rs1220071376 352 dbSNP
rs1367142271 359 dbSNP
rs1016920191 363 dbSNP
rs999630140 367 dbSNP
rs1337224360 368 dbSNP
rs551270455 371 dbSNP
rs567843605 380 dbSNP
rs1030613644 384 dbSNP
rs994197020 390 dbSNP
rs1360351956 396 dbSNP
rs77253791 410 dbSNP
rs751502987 412 dbSNP
rs1422607842 413 dbSNP
rs1192229563 432 dbSNP
rs576960361 433 dbSNP
rs1211328952 434 dbSNP
rs953342985 442 dbSNP
rs14911 455 dbSNP
rs868240274 458 dbSNP
rs182353543 460 dbSNP
rs1023848166 473 dbSNP
rs866117436 475 dbSNP
rs571723908 476 dbSNP
rs372681721 478 dbSNP
rs972497547 479 dbSNP
rs1311898909 488 dbSNP
rs969659763 508 dbSNP
rs1200179527 510 dbSNP
rs1377301556 523 dbSNP
rs780712074 526 dbSNP
rs980121503 531 dbSNP
rs1372949888 542 dbSNP
rs1381229967 552 dbSNP
rs1302983451 556 dbSNP
rs1474633648 558 dbSNP
rs1173221995 569 dbSNP
rs567011745 577 dbSNP
rs140365000 604 dbSNP
rs760371005 607 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gucuuaggaacggaCCCACg 5'
                        ||||| 
Target 5' --------------GGGUGa 3'
 		1 - 6
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_ControlB_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control B
Location of target site ENST00000312513.5 | 3UTR | GGGUGAUGAGGCUGCUGGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
172 hsa-miR-500b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT059905 HDGF heparin binding growth factor 2 4
MIRT235394 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 4
MIRT442246 PYGO1 pygopus family PHD finger 1 2 2
MIRT443591 ZNF439 zinc finger protein 439 2 4
MIRT453280 EFTUD2 elongation factor Tu GTP binding domain containing 2 2 2
MIRT463540 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT465589 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT469462 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT485449 KCTD15 potassium channel tetramerization domain containing 15 2 4
MIRT486682 WDR81 WD repeat domain 81 2 2
MIRT489078 POLM DNA polymerase mu 2 2
MIRT493734 GREM2 gremlin 2, DAN family BMP antagonist 2 2
MIRT494872 DYNLL2 dynein light chain LC8-type 2 2 2
MIRT496130 RNF103-CHMP3 RNF103-CHMP3 readthrough 2 2
MIRT496489 CHMP3 charged multivesicular body protein 3 2 2
MIRT496924 CLMN calmin 2 2
MIRT497297 TMEM119 transmembrane protein 119 2 2
MIRT499103 AGRN agrin 2 2
MIRT508979 CXorf38 chromosome X open reading frame 38 2 2
MIRT509911 NIPAL1 NIPA like domain containing 1 2 2
MIRT512820 ARRDC2 arrestin domain containing 2 2 4
MIRT512827 KBTBD6 kelch repeat and BTB domain containing 6 2 4
MIRT515360 MRPL52 mitochondrial ribosomal protein L52 2 2
MIRT516610 TRIM58 tripartite motif containing 58 2 2
MIRT517053 TLDC1 TBC/LysM-associated domain containing 1 2 2
MIRT517637 ZNF491 zinc finger protein 491 2 2
MIRT518270 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT518625 STAR steroidogenic acute regulatory protein 2 2
MIRT518887 N4BP2L2 NEDD4 binding protein 2 like 2 2 2
MIRT519026 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT520365 UBE2G2 ubiquitin conjugating enzyme E2 G2 2 2
MIRT521106 SLC1A5 solute carrier family 1 member 5 2 2
MIRT521943 PHC3 polyhomeotic homolog 3 2 2
MIRT522253 NPEPPS aminopeptidase puromycin sensitive 2 2
MIRT522853 KIAA1551 KIAA1551 2 2
MIRT522868 KIAA1549 KIAA1549 2 2
MIRT524207 DDX19B DEAD-box helicase 19B 2 2
MIRT526004 ARHGAP27 Rho GTPase activating protein 27 2 2
MIRT527769 RRAD RRAD, Ras related glycolysis inhibitor and calcium channel regulator 2 2
MIRT527827 TMEM74B transmembrane protein 74B 2 2
MIRT527861 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT528040 WT1 Wilms tumor 1 2 2
MIRT529802 ZDHHC8 zinc finger DHHC-type containing 8 2 2
MIRT531723 TARS threonyl-tRNA synthetase 2 2
MIRT531996 BARD1 BRCA1 associated RING domain 1 2 2
MIRT533338 UNC119B unc-119 lipid binding chaperone B 2 2
MIRT533621 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT533652 TMOD2 tropomodulin 2 2 2
MIRT534397 SENP3 SUMO1/sentrin/SMT3 specific peptidase 3 2 2
MIRT538686 CCDC80 coiled-coil domain containing 80 2 2
MIRT540444 RBM43 RNA binding motif protein 43 2 2
MIRT542586 ZC3H12C zinc finger CCCH-type containing 12C 2 8
MIRT542796 PLEKHA3 pleckstrin homology domain containing A3 2 4
MIRT542991 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT544424 ZNF460 zinc finger protein 460 2 4
MIRT545740 ESF1 ESF1 nucleolar pre-rRNA processing protein homolog 2 4
MIRT552618 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT554456 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT569663 PRIM1 DNA primase subunit 1 2 2
MIRT569924 PCSK9 proprotein convertase subtilisin/kexin type 9 2 2
MIRT570140 IL1RL2 interleukin 1 receptor like 2 2 2
MIRT573558 TMEM120B transmembrane protein 120B 2 2
MIRT574282 OPRD1 opioid receptor delta 1 2 2
MIRT575335 Fbxo6 F-box protein 6 2 2
MIRT607057 IDS iduronate 2-sulfatase 2 2
MIRT607078 POM121L7 POM121 transmembrane nucleoporin like 7 pseudogene 2 2
MIRT607500 HEBP2 heme binding protein 2 2 2
MIRT607530 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT607808 RHBDL2 rhomboid like 2 2 2
MIRT608079 ZFP14 ZFP14 zinc finger protein 2 2
MIRT609119 NUDT3 nudix hydrolase 3 2 2
MIRT609745 PTCH1 patched 1 2 2
MIRT612904 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 2 2
MIRT618720 PCSK2 proprotein convertase subtilisin/kexin type 2 2 2
MIRT618778 HLA-E major histocompatibility complex, class I, E 2 2
MIRT619015 SLC2A6 solute carrier family 2 member 6 2 2
MIRT623223 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT623819 GEMIN6 gem nuclear organelle associated protein 6 2 2
MIRT625704 OPTN optineurin 2 2
MIRT626437 CHDH choline dehydrogenase 2 2
MIRT628087 KAT7 lysine acetyltransferase 7 2 2
MIRT628936 APOB apolipoprotein B 2 2
MIRT633543 PGBD5 piggyBac transposable element derived 5 2 2
MIRT634348 SGOL1 shugoshin 1 2 2
MIRT634611 KIAA1919 major facilitator superfamily domain containing 4B 2 2
MIRT635243 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT636681 BTLA B and T lymphocyte associated 2 2
MIRT636923 ZNF845 zinc finger protein 845 2 2
MIRT637606 ZNF554 zinc finger protein 554 2 2
MIRT639242 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT640835 POLR3A RNA polymerase III subunit A 2 2
MIRT642098 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT643087 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT643934 C17orf104 meiosis specific with coiled-coil domain 2 2
MIRT644353 FXN frataxin 2 2
MIRT645628 SF3A3 splicing factor 3a subunit 3 2 2
MIRT645754 FAM213A family with sequence similarity 213 member A 2 2
MIRT646329 MVB12B multivesicular body subunit 12B 2 2
MIRT646817 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT647019 ADCY2 adenylate cyclase 2 2 2
MIRT647621 IGSF9B immunoglobulin superfamily member 9B 2 2
MIRT648517 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT648871 ABCA6 ATP binding cassette subfamily A member 6 2 2
MIRT649620 ITPKC inositol-trisphosphate 3-kinase C 2 2
MIRT650062 CCDC134 coiled-coil domain containing 134 2 2
MIRT650734 TNFSF8 TNF superfamily member 8 2 2
MIRT652389 TMEM55A phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 2 2
MIRT654352 RBM27 RNA binding motif protein 27 2 2
MIRT655796 NOVA2 NOVA alternative splicing regulator 2 2 2
MIRT657329 HNRNPK heterogeneous nuclear ribonucleoprotein K 2 2
MIRT657734 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT660613 ANO6 anoctamin 6 2 2
MIRT661243 ARL17B ADP ribosylation factor like GTPase 17B 2 2
MIRT662245 PGBD4 piggyBac transposable element derived 4 2 2
MIRT662921 MED18 mediator complex subunit 18 2 2
MIRT662963 JPH2 junctophilin 2 2 2
MIRT663347 ZNF74 zinc finger protein 74 2 2
MIRT663528 MASTL microtubule associated serine/threonine kinase like 2 2
MIRT663547 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663977 ZNF786 zinc finger protein 786 2 2
MIRT664084 METTL2B methyltransferase like 2B 2 2
MIRT664358 C16orf45 chromosome 16 open reading frame 45 2 2
MIRT664421 TIGD6 tigger transposable element derived 6 2 2
MIRT664476 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT664979 TDRD1 tudor domain containing 1 2 2
MIRT665128 PYCRL pyrroline-5-carboxylate reductase 3 2 2
MIRT666259 SLC31A1 solute carrier family 31 member 1 2 2
MIRT666321 SLC16A10 solute carrier family 16 member 10 2 2
MIRT666881 POLQ DNA polymerase theta 2 2
MIRT668469 FADS6 fatty acid desaturase 6 2 2
MIRT669554 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT669835 ISCA2 iron-sulfur cluster assembly 2 2 2
MIRT670185 CCDC142 coiled-coil domain containing 142 2 2
MIRT672020 PXMP4 peroxisomal membrane protein 4 2 2
MIRT672070 KIAA0930 KIAA0930 2 2
MIRT672475 RTTN rotatin 2 2
MIRT672851 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT673090 AK1 adenylate kinase 1 2 2
MIRT673581 KDELC2 KDEL motif containing 2 2 2
MIRT674586 SLC35B4 solute carrier family 35 member B4 2 2
MIRT675001 STRN3 striatin 3 2 2
MIRT679018 MTMR10 myotubularin related protein 10 2 2
MIRT679680 STAT3 signal transducer and activator of transcription 3 2 2
MIRT682833 FLG2 filaggrin family member 2 2 2
MIRT682886 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT683442 AP3B2 adaptor related protein complex 3 beta 2 subunit 2 2
MIRT687040 RNF115 ring finger protein 115 2 2
MIRT691957 RHOH ras homolog family member H 2 2
MIRT694625 ZFPM1 zinc finger protein, FOG family member 1 2 2
MIRT695637 SLC26A2 solute carrier family 26 member 2 2 2
MIRT697640 WRN Werner syndrome RecQ like helicase 2 2
MIRT702009 MIDN midnolin 2 2
MIRT702034 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
MIRT704789 CDK6 cyclin dependent kinase 6 2 2
MIRT705728 AMMECR1L AMMECR1 like 2 2
MIRT705879 ADM adrenomedullin 2 2
MIRT706220 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT708418 CERS4 ceramide synthase 4 2 2
MIRT709114 C3orf18 chromosome 3 open reading frame 18 2 2
MIRT709595 ITPA inosine triphosphatase 2 2
MIRT710945 MRPL45 mitochondrial ribosomal protein L45 2 2
MIRT712345 NLN neurolysin 2 2
MIRT712530 CYTH2 cytohesin 2 2 2
MIRT714019 ASCC1 activating signal cointegrator 1 complex subunit 1 2 2
MIRT717287 ARMC12 armadillo repeat containing 12 2 2
MIRT717733 FGF1 fibroblast growth factor 1 2 2
MIRT718083 CLIC5 chloride intracellular channel 5 2 2
MIRT718562 MUC20 mucin 20, cell surface associated 2 2
MIRT721639 MYLK3 myosin light chain kinase 3 2 2
MIRT722632 C8A complement C8 alpha chain 2 2
MIRT723177 CDCA4 cell division cycle associated 4 2 2
MIRT725523 FAM229B family with sequence similarity 229 member B 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-500b Methotrexate 126941 NSC740 approved resistant cell line (W1)
hsa-miR-500b-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-500b-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-500b-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-500b-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-500b-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-500b-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)

Error report submission