pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6511b-1 |
Genomic Coordinates | chr16: 2106669 - 2106753 |
Description | Homo sapiens miR-6511b-1 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
pre-miRNA | hsa-mir-6511b-2 |
Genomic Coordinates | chr16: 15134075 - 15134145 |
Description | Homo sapiens miR-6511b-2 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6511b-3p | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence | 53| CCUCACCACCCCUUCUGCCUGCA |75 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Experiments | Illumina | DRVs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |
---|---|
Gene Symbol | MED7 |
Synonyms | ARC34, CRSP33, CRSP9 |
Description | mediator complex subunit 7 |
Transcript | NM_001100816 |
Other Transcripts | NM_004270 |
Expression | |
Putative miRNA Targets on MED7 | |
3'UTR of MED7 (miRNA target sites are highlighted) |
>MED7|NM_001100816|3'UTR 1 AAGATGTTTCTTTTTCTTTTTTTCCTTTTGATAATAGCATCATATATTAGTTCATTTTCTTTTGGACAGTCTTAAGAGAA 81 GTTTCACTAAAAATGTAAACAGCTTTAATCTTGACTCCAAATTTTTCAATTATGAGATGTCATAGGCAGTAATTTCGCTG 161 TATAACAAGCATAGACAAATGAGTGTCCCTGCACTAAGAAGAATCACTTTAAAAAGCAAAGTGTTAGCTGCTGTTGTATG 241 GGACATTCCTATGTTTTAGAGTTGCAGTAAAACTTTGATGATAACCTCAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
DRVs in gene 3'UTRs | |
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HeLa | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B
HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
CLIP-seq Support 1 for dataset Chi_124B_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + B |
Location of target site | ENST00000286317.5 | 3UTR | UAUGGUGAGGGAGGAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset Chi_ControlB_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell Control B |
Location of target site | ENST00000286317.5 | 3UTR | UAUGGUGAGGGAGGAGGUU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
69 hsa-miR-6511b-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT059269 | CELF1 | CUGBP Elav-like family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT061287 | IPO7 | importin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT115533 | MAZ | MYC associated zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT345986 | BIRC5 | baculoviral IAP repeat containing 5 | ![]() |
![]() |
2 | 8 | ||||||
MIRT379536 | HNRNPK | heterogeneous nuclear ribonucleoprotein K | ![]() |
![]() |
2 | 2 | ||||||
MIRT442491 | RBBP5 | RB binding protein 5, histone lysine methyltransferase complex subunit | ![]() |
![]() |
2 | 8 | ||||||
MIRT443701 | HUNK | hormonally up-regulated Neu-associated kinase | ![]() |
![]() |
2 | 4 | ||||||
MIRT459167 | HSPA6 | heat shock protein family A (Hsp70) member 6 | ![]() |
![]() |
2 | 21 | ||||||
MIRT497179 | ZBTB40 | zinc finger and BTB domain containing 40 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497846 | GATA6 | GATA binding protein 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT519625 | ZNF781 | zinc finger protein 781 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519838 | ZFP69B | ZFP69 zinc finger protein B | ![]() |
![]() |
2 | 4 | ||||||
MIRT528560 | DNAAF3 | dynein axonemal assembly factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530718 | ORMDL3 | ORMDL sphingolipid biosynthesis regulator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530810 | GPR182 | G protein-coupled receptor 182 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533265 | VAV3 | vav guanine nucleotide exchange factor 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT533726 | TMEM246 | transmembrane protein 246 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535547 | P2RY2 | purinergic receptor P2Y2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536019 | MCUR1 | mitochondrial calcium uniporter regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539494 | ACTN4 | actinin alpha 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541793 | MGAT5 | mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase | ![]() |
![]() |
2 | 8 | ||||||
MIRT554509 | RUNX1T1 | RUNX1 translocation partner 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558784 | CEP55 | centrosomal protein 55 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560013 | ZNF525 | zinc finger protein 525 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560078 | ZNF195 | zinc finger protein 195 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570135 | IL1RL2 | interleukin 1 receptor like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570890 | ZNF780A | zinc finger protein 780A | ![]() |
![]() |
2 | 2 | ||||||
MIRT607972 | SNX22 | sorting nexin 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608104 | CRISPLD2 | cysteine rich secretory protein LCCL domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610471 | ADAMTS13 | ADAM metallopeptidase with thrombospondin type 1 motif 13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT611134 | GGT7 | gamma-glutamyltransferase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT611448 | NRIP3 | nuclear receptor interacting protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT613019 | GABPB1 | GA binding protein transcription factor beta subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT615753 | C6 | complement C6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620464 | CERS6 | ceramide synthase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632248 | VPS41 | VPS41, HOPS complex subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT636099 | ZDHHC22 | zinc finger DHHC-type containing 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637452 | ZNF324B | zinc finger protein 324B | ![]() |
![]() |
2 | 2 | ||||||
MIRT638927 | CALCOCO2 | calcium binding and coiled-coil domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT646768 | WDR3 | WD repeat domain 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652610 | TIMM8A | translocase of inner mitochondrial membrane 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT652868 | TAB1 | TGF-beta activated kinase 1 (MAP3K7) binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653655 | SLC27A4 | solute carrier family 27 member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657089 | JMY | junction mediating and regulatory protein, p53 cofactor | ![]() |
![]() |
2 | 2 | ||||||
MIRT657884 | GFPT1 | glutamine--fructose-6-phosphate transaminase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662919 | MED18 | mediator complex subunit 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT685622 | C12orf49 | chromosome 12 open reading frame 49 | ![]() |
![]() |
2 | 2 | ||||||
MIRT687427 | NRIP1 | nuclear receptor interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692304 | CNNM3 | cyclin and CBS domain divalent metal cation transport mediator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695127 | PRY2 | PTPN13-like, Y-linked 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695144 | PRY | PTPN13-like, Y-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT696286 | IER3IP1 | immediate early response 3 interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699350 | SLC35E1 | solute carrier family 35 member E1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709901 | AGO1 | argonaute 1, RISC catalytic component | ![]() |
![]() |
2 | 2 | ||||||
MIRT710877 | SLC25A42 | solute carrier family 25 member 42 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711365 | MED7 | mediator complex subunit 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711444 | FRMPD3 | FERM and PDZ domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713221 | RCAN2 | regulator of calcineurin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713281 | LAIR1 | leukocyte associated immunoglobulin like receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714195 | TRAF7 | TNF receptor associated factor 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715152 | IL12B | interleukin 12B | ![]() |
![]() |
2 | 2 | ||||||
MIRT719197 | CASP10 | caspase 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719469 | SRF | serum response factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT720197 | MPP6 | membrane palmitoylated protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720449 | SLC16A5 | solute carrier family 16 member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720461 | RAB31 | RAB31, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT721646 | ZNF207 | zinc finger protein 207 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722001 | CLLU1OS | chronic lymphocytic leukemia up-regulated 1 opposite strand | ![]() |
![]() |
2 | 2 | ||||||
MIRT725521 | FAM229B | family with sequence similarity 229 member B | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|