pre-miRNA Information
pre-miRNA hsa-mir-6737   
Genomic Coordinates chr1: 153962351 - 153962420
Description Homo sapiens miR-6737 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6737-5p
Sequence 6| UUGGGGUGGUCGGCCCUGGAG |26
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs766338599 4 dbSNP
rs765728788 7 dbSNP
rs757341439 9 dbSNP
rs539511149 11 dbSNP
rs764259486 12 dbSNP
rs988937601 21 dbSNP
Putative Targets

Gene Information
Gene Symbol NUPL2   
Synonyms CG1, NLP-1, NLP_1, hCG1
Description nucleoporin like 2
Transcript NM_007342   
Expression
Putative miRNA Targets on NUPL2
3'UTR of NUPL2
(miRNA target sites are highlighted)
>NUPL2|NM_007342|3'UTR
   1 AAGGGCAATTTTAAATACAAAAAAGAATGATGTTTAAAATTGCTTTGAGTGATTCATACAGAGATGTATATATGCATACA
  81 TGTATATATTCATAAGGAATATAAGCTTCCATCAATAGTGATTTTAAATTTGATTTTTTTCTTAACTCTAAATATTTAAG
 161 TAAAAAGTAACAAAAACTCTGCAAGCAAGGGAATTTTTTTGTACTGTAATTTTGAATGGAACTGAAAAATTATGCACGAA
 241 TAAAGTACTTTTCTCATGCCATACCAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' gaggucccggcUGGUGGGGUu 5'
                     :|||: ||| 
Target 5' acttttctcatGCCATACCAa 3'
247 - 267 98.00 -10.80
2
miRNA  3' gaggucccggcuggUGGGGUu 5'
                        ||:|:| 
Target 5' tgatttttttcttaACTCTAa 3'
131 - 151 88.00 -7.20
3
miRNA  3' gaggucccggcuggUGGGGUu 5'
                        ||:|:: 
Target 5' aaaaagtaacaaaaACTCTGc 3'
162 - 182 72.00 -5.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30193280 38 COSMIC
COSN30549401 41 COSMIC
COSN31495696 48 COSMIC
COSN31591740 75 COSMIC
COSN2216494 185 COSMIC
COSN25330755 208 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs748387977 5 dbSNP
rs745757480 7 dbSNP
rs1045525293 8 dbSNP
rs1272034455 19 dbSNP
rs373279202 19 dbSNP
rs773049005 21 dbSNP
rs1308918763 26 dbSNP
rs1298134939 27 dbSNP
rs1278990160 29 dbSNP
rs1213182760 30 dbSNP
rs1052636220 38 dbSNP
rs1237846571 43 dbSNP
rs760438763 48 dbSNP
rs1453740547 56 dbSNP
rs562923870 57 dbSNP
rs1462642024 58 dbSNP
rs771786821 62 dbSNP
rs1356524073 65 dbSNP
rs1167990425 67 dbSNP
rs1448633115 80 dbSNP
rs772511012 87 dbSNP
rs912780405 87 dbSNP
rs1402473493 88 dbSNP
rs778057942 93 dbSNP
rs1452558866 107 dbSNP
rs1265998234 108 dbSNP
rs944303387 112 dbSNP
rs531960291 116 dbSNP
rs757719382 117 dbSNP
rs1249272930 121 dbSNP
rs1341891364 129 dbSNP
rs545143556 129 dbSNP
rs995493897 131 dbSNP
rs565394105 133 dbSNP
rs1237109969 134 dbSNP
rs1048937419 144 dbSNP
rs868812831 144 dbSNP
rs1300626364 154 dbSNP
rs911313028 159 dbSNP
rs964193774 160 dbSNP
rs781681484 161 dbSNP
rs1306100167 163 dbSNP
rs185960233 165 dbSNP
rs547816205 167 dbSNP
rs1429399224 168 dbSNP
rs935568681 171 dbSNP
rs1375813718 174 dbSNP
rs1175306936 177 dbSNP
rs75352203 181 dbSNP
rs1377005835 182 dbSNP
rs1005092930 188 dbSNP
rs1420337194 194 dbSNP
rs1247886718 202 dbSNP
rs1485820446 203 dbSNP
rs1234240318 205 dbSNP
rs918066809 207 dbSNP
rs1353437680 215 dbSNP
rs746364290 217 dbSNP
rs1045475252 226 dbSNP
rs879017639 229 dbSNP
rs879330229 232 dbSNP
rs10634 233 dbSNP
rs1215117445 234 dbSNP
rs1023589783 238 dbSNP
rs549296655 239 dbSNP
rs568938910 240 dbSNP
rs1001332699 242 dbSNP
rs1196695026 249 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A HITS-CLIP data was present in Chi_ControlB_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + A
Location of target site ENST00000258742.5 | 3UTR | AAGAGGGAGGUAGUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset Chi_124B_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + B
Location of target site ENST00000258742.5 | 3UTR | AAGAGGGAGGUAGUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset Chi_ControlA_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control A
Location of target site ENST00000258742.5 | 3UTR | AAGAGGGAGGUAGUAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset Chi_ControlB_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control B
Location of target site ENST00000258742.5 | 3UTR | AAGAGGGAGGUAGUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
67 hsa-miR-6737-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066215 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT074413 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT125300 MID1IP1 MID1 interacting protein 1 2 2
MIRT153951 NCOA3 nuclear receptor coactivator 3 2 2
MIRT452776 FAM136A family with sequence similarity 136 member A 2 2
MIRT452977 CABP4 calcium binding protein 4 2 2
MIRT454128 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 2
MIRT455242 DDX39B DExD-box helicase 39B 2 10
MIRT459007 UQCRH ubiquinol-cytochrome c reductase hinge protein 2 2
MIRT459463 MUC17 mucin 17, cell surface associated 2 4
MIRT460871 UBE2S ubiquitin conjugating enzyme E2 S 2 2
MIRT461264 COX10 COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor 2 2
MIRT464540 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT465268 TRIM28 tripartite motif containing 28 2 2
MIRT465871 TMEM43 transmembrane protein 43 2 4
MIRT466228 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT468417 SETD1B SET domain containing 1B 2 2
MIRT468684 SEC22C SEC22 homolog C, vesicle trafficking protein 2 4
MIRT473399 MDM4 MDM4, p53 regulator 2 2
MIRT473517 MAX MYC associated factor X 2 2
MIRT474511 KLHDC8A kelch domain containing 8A 2 2
MIRT475801 HDGF heparin binding growth factor 2 2
MIRT479493 CDH6 cadherin 6 2 2
MIRT480770 BMP2 bone morphogenetic protein 2 2 2
MIRT481418 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT482966 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT483380 SPATA6 spermatogenesis associated 6 2 4
MIRT483677 CYP11A1 cytochrome P450 family 11 subfamily A member 1 2 2
MIRT484328 EPN1 epsin 1 2 4
MIRT484963 UCK1 uridine-cytidine kinase 1 2 2
MIRT485908 PGPEP1 pyroglutamyl-peptidase I 2 4
MIRT488149 PRRC2B proline rich coiled-coil 2B 2 4
MIRT488943 CYP2W1 cytochrome P450 family 2 subfamily W member 1 2 6
MIRT491835 ZBTB7A zinc finger and BTB domain containing 7A 2 4
MIRT493026 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT499374 PLCG2 phospholipase C gamma 2 2 11
MIRT499723 USH1G USH1 protein network component sans 2 4
MIRT500349 ZNF385A zinc finger protein 385A 2 2
MIRT509574 HIST2H2AB histone cluster 2 H2A family member b 2 4
MIRT512794 GLRX glutaredoxin 2 2
MIRT513291 SETBP1 SET binding protein 1 2 2
MIRT515697 ZNF321P zinc finger protein 321, pseudogene 2 2
MIRT518255 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT522026 PAQR3 progestin and adipoQ receptor family member 3 2 4
MIRT523169 HIST3H3 histone cluster 3 H3 2 2
MIRT524036 DNAJC8 DnaJ heat shock protein family (Hsp40) member C8 2 2
MIRT533476 TRIM71 tripartite motif containing 71 2 2
MIRT541488 ADM adrenomedullin 2 2
MIRT553987 SRPR SRP receptor alpha subunit 2 2
MIRT571445 YKT6 YKT6 v-SNARE homolog 2 2
MIRT574889 Plcg2 phospholipase C, gamma 2 2 7
MIRT607544 GLI2 GLI family zinc finger 2 2 2
MIRT607688 MAPK10 mitogen-activated protein kinase 10 2 2
MIRT610072 CRLF1 cytokine receptor like factor 1 2 2
MIRT610573 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT614041 THBS2 thrombospondin 2 2 2
MIRT626318 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT634005 RIF1 replication timing regulatory factor 1 2 2
MIRT639619 FGF19 fibroblast growth factor 19 2 2
MIRT647343 RPH3AL rabphilin 3A like (without C2 domains) 2 2
MIRT689704 ATXN2 ataxin 2 2 2
MIRT691170 APOL6 apolipoprotein L6 2 2
MIRT693165 NPR1 natriuretic peptide receptor 1 2 2
MIRT711727 NUPL2 nucleoporin like 2 2 2
MIRT711806 ELN elastin 2 2
MIRT721546 FXN frataxin 2 2
MIRT722979 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-6737 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-6737 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-6737-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6737-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-6737-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6737-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-6737-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-6737-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-6737-5p Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)

Error report submission