pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4464 |
Genomic Coordinates | chr6: 90312742 - 90312833 |
Description | Homo sapiens miR-4464 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4464 | |||||||||||||||||||||||||||||||||||
Sequence | 12| AAGGUUUGGAUAGAUGCAAUA |32 | |||||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||||
Experiments | Illumina | |||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | NUDT7 | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | nudix hydrolase 7 | ||||||||||||||||||||
Transcript | NM_001105663 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on NUDT7 | |||||||||||||||||||||
3'UTR of NUDT7 (miRNA target sites are highlighted) |
>NUDT7|NM_001105663|3'UTR 1 TTTACTAGAGCAAGAGACAAAGAACTATTCACGAGGATTCTGTGTGTGCTTATTCGTAGAACAACAACAATGCCAGCTGT 81 TGGAATTTGACAGGTGTGAATATTTTTTCTGCAGTATGTAGTTAGAATCCTTGCCTCTTTTCCAGTTGCCTTCTATTGTC 161 TGAAAAAGTAAAAGCCATTCAAAAATGAAAACTATGTTCATAGTGTTGCATATTTTCACCCACAATATGTTAATAATATT 241 TTTCTTACACATATAATAAAGAATATCTGGCACATACTAGGCCCTTAATAAAGATTTTTTGAATATATAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HeLa |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
CLIP-seq Support 1 for dataset Chi_ControlA_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell Control A |
Location of target site | ENST00000564085.1 | 3UTR | aagggaaugacggcaaa |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
81 hsa-miR-4464 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT056004 | ARL5B | ADP ribosylation factor like GTPase 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT061568 | BTG2 | BTG anti-proliferation factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT078651 | ICT1 | mitochondrial ribosomal protein L58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT087551 | YWHAH | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta | ![]() |
![]() |
2 | 4 | ||||||
MIRT088139 | SEPT2 | septin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT095089 | SEC24A | SEC24 homolog A, COPII coat complex component | ![]() |
![]() |
2 | 4 | ||||||
MIRT099065 | FOXC1 | forkhead box C1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT150194 | MIDN | midnolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT178173 | EIF5AL1 | eukaryotic translation initiation factor 5A-like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT178942 | C11ORF57 | chromosome 11 open reading frame 57 | ![]() |
![]() |
2 | 2 | ||||||
MIRT188776 | SESN2 | sestrin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT267026 | EFHD2 | EF-hand domain family member D2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT307213 | ACVR2B | activin A receptor type 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT324750 | ACER2 | alkaline ceramidase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442732 | TEAD1 | TEA domain transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444087 | C12orf73 | chromosome 12 open reading frame 73 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445527 | KLF9 | Kruppel like factor 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449604 | INIP | INTS3 and NABP interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT451129 | ZNF99 | zinc finger protein 99 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452271 | RPL30 | ribosomal protein L30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452486 | DDX4 | DEAD-box helicase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454868 | DNAJC15 | DnaJ heat shock protein family (Hsp40) member C15 | ![]() |
![]() |
2 | 6 | ||||||
MIRT455773 | TSPAN6 | tetraspanin 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT463844 | WRN | Werner syndrome RecQ like helicase | ![]() |
![]() |
2 | 2 | ||||||
MIRT465036 | TTC39C | tetratricopeptide repeat domain 39C | ![]() |
![]() |
2 | 2 | ||||||
MIRT465176 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT465294 | TRIB3 | tribbles pseudokinase 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT467931 | SLC16A7 | solute carrier family 16 member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471906 | NUAK2 | NUAK family kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472724 | MTUS1 | microtubule associated scaffold protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT479785 | CCND1 | cyclin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482446 | ADM | adrenomedullin | ![]() |
![]() |
2 | 10 | ||||||
MIRT485365 | MYLIP | myosin regulatory light chain interacting protein | ![]() |
![]() |
2 | 12 | ||||||
MIRT498399 | KIF6 | kinesin family member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT503202 | ACTB | actin beta | ![]() |
![]() |
2 | 6 | ||||||
MIRT503819 | TMEM242 | transmembrane protein 242 | ![]() |
![]() |
2 | 2 | ||||||
MIRT504706 | ZNF117 | zinc finger protein 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT507802 | CDKN1B | cyclin dependent kinase inhibitor 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT509968 | KANSL1L | KAT8 regulatory NSL complex subunit 1 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT517306 | ELF4 | E74 like ETS transcription factor 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT523900 | ENPP6 | ectonucleotide pyrophosphatase/phosphodiesterase 6 | ![]() |
![]() |
2 | 6 | ||||||
MIRT532018 | NOX5 | NADPH oxidase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535334 | PHACTR2 | phosphatase and actin regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536944 | HCN4 | hyperpolarization activated cyclic nucleotide gated potassium channel 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT539322 | AHSA2 | activator of HSP90 ATPase homolog 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540189 | GSTM4 | glutathione S-transferase mu 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545015 | ZNF439 | zinc finger protein 439 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545265 | TRIM36 | tripartite motif containing 36 | ![]() |
![]() |
2 | 4 | ||||||
MIRT547230 | PAG1 | phosphoprotein membrane anchor with glycosphingolipid microdomains 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548425 | ELOVL5 | ELOVL fatty acid elongase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549910 | ADH4 | alcohol dehydrogenase 4 (class II), pi polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT550185 | TMEM106C | transmembrane protein 106C | ![]() |
![]() |
2 | 2 | ||||||
MIRT550775 | ENOX2 | ecto-NOX disulfide-thiol exchanger 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT552401 | ZNF487P | zinc finger protein 487 | ![]() |
1 | 1 | |||||||
MIRT554782 | RHEBP1 | RHEB pseudogene 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT557311 | HIF1A | hypoxia inducible factor 1 alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT558635 | CNNM2 | cyclin and CBS domain divalent metal cation transport mediator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563168 | RPS14 | ribosomal protein S14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564886 | YWHAE | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon | ![]() |
![]() |
2 | 2 | ||||||
MIRT565778 | SEPHS1 | selenophosphate synthetase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566480 | PDCD4 | programmed cell death 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT567206 | IGFBP5 | insulin like growth factor binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568931 | SMCR8 | Smith-Magenis syndrome chromosome region, candidate 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570698 | FBXO41 | F-box protein 41 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573474 | MTRNR2L9 | MT-RNR2-like 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT576170 | Hmox1 | heme oxygenase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607555 | GLI2 | GLI family zinc finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608203 | ERBB2 | erb-b2 receptor tyrosine kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609779 | VWC2L | von Willebrand factor C domain containing protein 2 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT616312 | CELF2 | CUGBP Elav-like family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617190 | CDH13 | cadherin 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT626842 | RPLP1 | ribosomal protein lateral stalk subunit P1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636438 | MARCH1 | membrane associated ring-CH-type finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639101 | GLIPR1L2 | GLI pathogenesis related 1 like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691018 | CRTC3 | CREB regulated transcription coactivator 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700008 | RPS21 | ribosomal protein S21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701144 | PANK1 | pantothenate kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712691 | NUDT7 | nudix hydrolase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715505 | MAZ | MYC associated zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT722509 | PTPRC | protein tyrosine phosphatase, receptor type C | ![]() |
![]() |
2 | 2 | ||||||
MIRT724982 | TNS1 | tensin 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | |||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|