pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6751 |
Genomic Coordinates | chr11: 65129916 - 65129978 |
Description | Homo sapiens miR-6751 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6751-3p | ||||||||||||||||||||||||||||||
Sequence | 43| ACUGAGCCUCUCUCUCUCCAG |63 | ||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||
Experiments | Meta-analysis | DRVs in miRNA |
|
||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | CYB5R4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | NCB5OR, cb5/cb5R, dJ676J13.1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | cytochrome b5 reductase 4 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_016230 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on CYB5R4 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of CYB5R4 (miRNA target sites are highlighted) |
>CYB5R4|NM_016230|3'UTR 1 TGAAGAGCTGTCATTGTCCTTTATTCAACTAGTTTATCTAAATTTGTGATTGCTTAGGGTTTTTTAAGAGAACATTTTTG 81 TACATAACAAAAGGTTAACTAGAATCCAGCCTTCAGTTTCTTAAATGAAATCAAATGTTCCTTCAGTACAGGTAACTTCT 161 TGGCTTTCTTTTGTACCACAACTTATTTTACTACTGATATTTGACCTGGAAAGTTAATCATGGCAACAAATACATACAGG 241 ATTCTTTGTTATGAATCACAAATTTCCTTGCCATTTAAATTATATCACTGTTCTACAATAAGCACTTGTGTTTTATGACA 321 TGATAAAGTAAATGATCACTTCGATCATGTTTCTATGCTGTAAAATGTCTTATTAGCAATACAGATTAAATTTTACCTTG 401 CACTGTTAACTCAGGAAATGATCATTTATGTCCTTGTTATTAATGTTAAAACATAGAATGTTATAACTTATTAAGTGATC 481 CAAACATTTTTTTGTGTGTGTATGGCATTGATGCAGAATAGAATAAAATTATACTTAAGTTCTTTTTAAAAAAAAAAAAA 561 A Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HeLa | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
CLIP-seq Support 1 for dataset Chi_ControlA_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell Control A |
Location of target site | ENST00000369681.5 | 3UTR | AGAAGAAGACAGGAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
77 hsa-miR-6751-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT130738 | GATAD2B | GATA zinc finger domain containing 2B | ![]() |
![]() |
2 | 4 | ||||||
MIRT134924 | CCND2 | cyclin D2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT273034 | ZBTB18 | zinc finger and BTB domain containing 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT276645 | KPNA3 | karyopherin subunit alpha 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT446531 | OAS2 | 2'-5'-oligoadenylate synthetase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT456268 | TDRKH | tudor and KH domain containing | ![]() |
![]() |
2 | 12 | ||||||
MIRT494454 | BTG2 | BTG anti-proliferation factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT494965 | USP46 | ubiquitin specific peptidase 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496689 | KREMEN1 | kringle containing transmembrane protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496697 | RGS11 | regulator of G protein signaling 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT504376 | IRF4 | interferon regulatory factor 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT510980 | PFN2 | profilin 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512548 | MFN2 | mitofusin 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT513639 | TP53INP2 | tumor protein p53 inducible nuclear protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT514016 | CAMSAP1 | calmodulin regulated spectrin associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT514074 | MTRNR2L6 | MT-RNR2-like 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT515300 | C15orf38-AP3S2 | C15orf38-AP3S2 readthrough | ![]() |
![]() |
2 | 4 | ||||||
MIRT517285 | AP3S2 | adaptor related protein complex 3 sigma 2 subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT519075 | KCNK6 | potassium two pore domain channel subfamily K member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520779 | TCF23 | transcription factor 23 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522485 | MFSD9 | major facilitator superfamily domain containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528856 | PKP1 | plakophilin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529081 | PATE2 | prostate and testis expressed 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531209 | PLA2G4D | phospholipase A2 group IVD | ![]() |
![]() |
2 | 2 | ||||||
MIRT533988 | TAB3 | TGF-beta activated kinase 1 and MAP3K7 binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT537024 | GRIN2B | glutamate ionotropic receptor NMDA type subunit 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT537498 | FAM168B | family with sequence similarity 168 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT553125 | UBE2Z | ubiquitin conjugating enzyme E2 Z | ![]() |
![]() |
2 | 2 | ||||||
MIRT555591 | PIP5K1C | phosphatidylinositol-4-phosphate 5-kinase type 1 gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT556370 | LUZP1 | leucine zipper protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569745 | C2orf71 | chromosome 2 open reading frame 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570149 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571243 | FADS6 | fatty acid desaturase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573065 | TRIB1 | tribbles pseudokinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575533 | Map4 | microtubule-associated protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575777 | Tnfrsf10b | tumor necrosis factor receptor superfamily, member 10b | ![]() |
![]() |
2 | 2 | ||||||
MIRT616558 | ZNF512B | zinc finger protein 512B | ![]() |
![]() |
2 | 2 | ||||||
MIRT624851 | ABI2 | abl interactor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630078 | GRWD1 | glutamate rich WD repeat containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT631479 | KLHL21 | kelch like family member 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT632173 | CCL22 | C-C motif chemokine ligand 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT638397 | QSOX2 | quiescin sulfhydryl oxidase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT641192 | ISG20L2 | interferon stimulated exonuclease gene 20 like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642562 | TEX9 | testis expressed 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642935 | KRTAP5-9 | keratin associated protein 5-9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649703 | ZNF175 | zinc finger protein 175 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650437 | CPXM2 | carboxypeptidase X, M14 family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652113 | TRUB2 | TruB pseudouridine synthase family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652273 | TOMM20 | translocase of outer mitochondrial membrane 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT655215 | PFKM | phosphofructokinase, muscle | ![]() |
![]() |
2 | 2 | ||||||
MIRT682778 | ZNF852 | zinc finger protein 852 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683001 | MUC20 | mucin 20, cell surface associated | ![]() |
![]() |
2 | 2 | ||||||
MIRT684320 | GTF3C4 | general transcription factor IIIC subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689435 | CYB561 | cytochrome b561 | ![]() |
![]() |
2 | 2 | ||||||
MIRT693847 | ZNF107 | zinc finger protein 107 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696715 | TAX1BP3 | Tax1 binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT698597 | TEX261 | testis expressed 261 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699973 | RREB1 | ras responsive element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703310 | GFPT1 | glutamine--fructose-6-phosphate transaminase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706796 | RAI1 | retinoic acid induced 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709004 | CD109 | CD109 molecule | ![]() |
![]() |
2 | 2 | ||||||
MIRT709181 | TBC1D10B | TBC1 domain family member 10B | ![]() |
![]() |
2 | 2 | ||||||
MIRT709835 | PAQR7 | progestin and adipoQ receptor family member 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711627 | CORO1C | coronin 1C | ![]() |
![]() |
2 | 2 | ||||||
MIRT712634 | RNF103-CHMP3 | RNF103-CHMP3 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT713694 | CYB5R4 | cytochrome b5 reductase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713752 | SLC9A8 | solute carrier family 9 member A8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714908 | CHMP3 | charged multivesicular body protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716371 | CBLL1 | Cbl proto-oncogene like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718303 | XPOT | exportin for tRNA | ![]() |
![]() |
2 | 2 | ||||||
MIRT718713 | ANKRD18A | ankyrin repeat domain 18A | ![]() |
![]() |
2 | 2 | ||||||
MIRT718740 | ATP9A | ATPase phospholipid transporting 9A (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT719441 | NPTX2 | neuronal pentraxin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720896 | OTUD4 | OTU deubiquitinase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722448 | RXFP4 | relaxin/insulin like family peptide receptor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723882 | VKORC1 | vitamin K epoxide reductase complex subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724586 | SYNJ2BP | synaptojanin 2 binding protein | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|