miRTarBase - #MIRT715216


—
pre-miRNA Information
pre-miRNA hsa-mir-921   
Genomic Coordinates chr1: 166154743 - 166154798
Synonyms MIRN921, hsa-mir-921, MIR921
Description Homo sapiens miR-921 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-921
Sequence 2| CUAGUGAGGGACAGAACCAGGAUUC |26
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31549221 11 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1464259216 3 dbSNP
rs768428855 8 dbSNP
rs746970999 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NPVF   
Synonyms C7orf9, RFRP
Description neuropeptide VF precursor
Transcript NM_022150   
Expression
Putative miRNA Targets on NPVF
3'UTR of NPVF
(miRNA target sites are highlighted)		 
>NPVF|NM_022150|3'UTR
   1 GAAACCTGGAGCCTGTCCCTAAAGCTGTGGCCTGTAATCTACAAATGGCTCTATAGCGAAGACCACACGGAAGAGTAGCT
  81 ACATACACTTCATCAGCTATGGATCATCAACGGCAATTTTTCCTTGTCAGTACAGCTATAATAGTATCTTGAAAGTTGTA
 161 AAAAAATTAAAGCATATTTGTTACGTAAAGTTAAAATGATTTTTGTCTGAATAAAAAAAAAGCATTGCAAATGCTTTAGA
 241 AATCTCTGATAATGGAGAGAGAGACAGAGGACCCTCCTCACTACCCTATATAAAAATCATTGGCACAGTTACACTTAATA
 321 AAAAAAATTAAACAGAAGAGCACCCTGAAAAACATTATGATGGAAATTAAATAGTATGCCAGAATAACATGGTTGACAAA
 401 TAAGTGAACAAGGATTAAAAATCACTTACAAACGTGTTTCTGTACACCCTTTCTATCGTGTCAAATGTTAATGAATCTGT
 481 GATCAATTGAAATGTAAATGTCTGTGTAAAACTACAAAATAAAAACTCTTAGACTTTAGGGAGAAAAGAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuuaggaccaagacaGGGAGUGAUc 5'
                         :|||||||| 
Target 5' agagacagaggacccTCCTCACTAc 3'
 260 - 284 146.00 -12.70
2 
miRNA  3' cuUAGGACCAAGACA---GGGAGUGAUc 5'
            | | || ||||||   ||||: ||| 
Target 5' caAACGTGTTTCTGTACACCCTTTCTAt 3'
 429 - 456 131.00 -15.60
3 
miRNA  3' cuUAG-GACCAAGACA--GGGAGUGAUc 5'
            ||| :|||  | ||  | ||:| || 
Target 5' aaATCATTGGCACAGTTACACTTAATAa 3'
 294 - 321 113.00 -8.16
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30497924 4 COSMIC
COSN31540679 7 COSMIC
COSN31553619 13 COSMIC
COSN28821011 25 COSMIC
COSN30152087 25 COSMIC
COSN26986906 39 COSMIC
COSN30165814 46 COSMIC
COSN30193437 49 COSMIC
COSN213171 52 COSMIC
COSN31526186 57 COSMIC
COSN28630142 68 COSMIC
COSN30171775 70 COSMIC
COSN30184227 80 COSMIC
COSN30496419 85 COSMIC
COSN30104172 108 COSMIC
COSN28201507 111 COSMIC
COSN31510228 114 COSMIC
COSN31593096 121 COSMIC
COSN30104145 123 COSMIC
COSN30187168 126 COSMIC
COSN30510927 137 COSMIC
COSN30510926 138 COSMIC
COSN31562273 160 COSMIC
COSN17579551 184 COSMIC
COSN31561445 212 COSMIC
COSN20070268 213 COSMIC
COSN5654823 271 COSMIC
COSN30115329 298 COSMIC
COSN1347692 325 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs770824027 1 dbSNP
rs760648180 4 dbSNP
rs574022279 5 dbSNP
rs1195797956 7 dbSNP
rs917462177 14 dbSNP
rs374104557 15 dbSNP
rs1262775242 17 dbSNP
rs1223437204 18 dbSNP
rs1361827263 19 dbSNP
rs748391029 24 dbSNP
rs779065510 25 dbSNP
rs768891973 27 dbSNP
rs1397726571 29 dbSNP
rs749375890 30 dbSNP
rs780165660 32 dbSNP
rs1338102585 34 dbSNP
rs992268803 35 dbSNP
rs553747268 46 dbSNP
rs199708914 48 dbSNP
rs907576296 49 dbSNP
rs983161434 54 dbSNP
rs1254470721 55 dbSNP
rs1229702941 56 dbSNP
rs1297526666 58 dbSNP
rs368412736 68 dbSNP
rs375749118 69 dbSNP
rs1289861281 73 dbSNP
rs974952263 75 dbSNP
rs1212762562 76 dbSNP
rs1250529550 82 dbSNP
rs968034564 83 dbSNP
rs577626545 84 dbSNP
rs1019258957 93 dbSNP
rs371337473 100 dbSNP
rs1164755691 104 dbSNP
rs1414327539 106 dbSNP
rs113811642 111 dbSNP
rs1030217162 112 dbSNP
rs997296554 117 dbSNP
rs537977348 125 dbSNP
rs1325177944 129 dbSNP
rs901563606 132 dbSNP
rs1450892479 134 dbSNP
rs1035996015 139 dbSNP
rs1309681684 146 dbSNP
rs1410202182 156 dbSNP
rs1330559516 158 dbSNP
rs1000201414 165 dbSNP
rs940398666 166 dbSNP
rs1161298136 167 dbSNP
rs1260489472 167 dbSNP
rs569800310 173 dbSNP
rs183197226 180 dbSNP
rs142505821 184 dbSNP
rs978095 185 dbSNP
rs1162993388 190 dbSNP
rs940316109 192 dbSNP
rs55789252 198 dbSNP
rs139084893 200 dbSNP
rs939423292 213 dbSNP
rs1490291098 214 dbSNP
rs571264391 215 dbSNP
rs924055382 216 dbSNP
rs974541504 217 dbSNP
rs1452367630 221 dbSNP
rs200857217 222 dbSNP
rs964885969 222 dbSNP
rs1228686684 223 dbSNP
rs1283709297 224 dbSNP
rs1259620171 226 dbSNP
rs1347928491 230 dbSNP
rs1202051903 236 dbSNP
rs1279271230 241 dbSNP
rs1222127173 243 dbSNP
rs1185503690 247 dbSNP
rs1253782542 249 dbSNP
rs987385038 252 dbSNP
rs73691518 253 dbSNP
rs1031602325 261 dbSNP
rs1000170313 265 dbSNP
rs1173634320 265 dbSNP
rs774332658 265 dbSNP
rs1375342709 267 dbSNP
rs531321971 268 dbSNP
rs118032448 276 dbSNP
rs968767898 281 dbSNP
rs1391538042 282 dbSNP
rs968065788 285 dbSNP
rs1305869146 286 dbSNP
rs1290140738 290 dbSNP
rs1022705211 296 dbSNP
rs985744076 297 dbSNP
rs1344659893 300 dbSNP
rs1276428799 302 dbSNP
rs954419884 307 dbSNP
rs1029835232 312 dbSNP
rs146193251 315 dbSNP
rs1248726469 322 dbSNP
rs1013031984 324 dbSNP
rs1199641028 328 dbSNP
rs895965496 328 dbSNP
rs570579661 330 dbSNP
rs1453109617 338 dbSNP
rs1350087691 340 dbSNP
rs1171035647 341 dbSNP
rs1317096097 343 dbSNP
rs1398450265 344 dbSNP
rs1413447037 345 dbSNP
rs763961194 347 dbSNP
rs190652058 348 dbSNP
rs1461815886 350 dbSNP
rs1297207676 354 dbSNP
rs60142768 355 dbSNP
rs1388212649 357 dbSNP
rs1325992150 358 dbSNP
rs1004346402 368 dbSNP
rs560374051 369 dbSNP
rs6956128 374 dbSNP
rs930285174 377 dbSNP
rs752743360 378 dbSNP
rs765199553 381 dbSNP
rs1193260734 382 dbSNP
rs920301302 389 dbSNP
rs947999794 390 dbSNP
rs1210730904 392 dbSNP
rs1252376185 396 dbSNP
rs895020190 399 dbSNP
rs577588940 401 dbSNP
rs527894206 404 dbSNP
rs1191005355 412 dbSNP
rs1391358231 428 dbSNP
rs776711965 429 dbSNP
rs557885232 433 dbSNP
rs1268796959 434 dbSNP
rs11976166 436 dbSNP
rs978200536 440 dbSNP
rs771099754 448 dbSNP
rs1393036620 453 dbSNP
rs1298987145 455 dbSNP
rs1438124701 455 dbSNP
rs915266640 457 dbSNP
rs183343764 458 dbSNP
rs1293169086 492 dbSNP
rs985827936 493 dbSNP
rs374011047 496 dbSNP
rs922882057 501 dbSNP
rs1272812206 504 dbSNP
rs1332714602 505 dbSNP
rs1210633699 515 dbSNP
rs1248776319 526 dbSNP
rs1269236609 527 dbSNP
rs976952801 528 dbSNP
rs1432372328 529 dbSNP
rs568599483 532 dbSNP
rs1015683348 533 dbSNP
rs1004605436 539 dbSNP
rs1023000297 549 dbSNP
rs1320599770 550 dbSNP
rs536488836 553 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_ControlA_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell Control A ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuuaggaccaagaCAGGGAGugauc 5'
                       | |||||     
Target 5' gagagagacagagGACCCUCc---- 3'
 		3 - 23
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_ControlA_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell Control A
Location of target site ENST00000222674.2 | 3UTR | GAGAGAGAGACAGAGGACCCUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.492 4.4e-2 0.379 1.0e-1 13 Click to see details
GSE32688 Pancreatic cancer 0.264 7.2e-2 0.298 4.9e-2 32 Click to see details
GSE17498 Multiple myeloma -0.14 1.9e-1 -0.033 4.2e-1 40 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.189 2.1e-1 0.044 4.3e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.155 2.3e-1 -0.152 2.3e-1 25 Click to see details
GSE19536 Breast cancer 0.06 2.8e-1 0.070 2.4e-1 100 Click to see details
GSE38226 Liver fibrosis -0.129 2.9e-1 -0.320 7.9e-2 21 Click to see details
GSE19783 ER+ ER+ breast cancer -0.123 3.0e-1 -0.117 3.1e-1 20 Click to see details
GSE28544 Breast cancer 0.11 3.0e-1 -0.015 4.7e-1 24 Click to see details
GSE19350 CNS germ cell tumors -0.09 3.9e-1 -0.014 4.8e-1 12 Click to see details
GSE21687 Ependynoma primary tumors 0.026 4.2e-1 -0.108 2.0e-1 64 Click to see details
GSE19783 ER- ER- breast cancer -0.016 4.4e-1 0.068 2.8e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells 0.002 5.0e-1 0.126 2.8e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.002 5.0e-1 0.126 2.8e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells 0.002 5.0e-1 0.126 2.8e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
63 hsa-miR-921 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT054764 ANGPTL1 angiopoietin like 1 3 1
MIRT066171 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT069409 ZFYVE21 zinc finger FYVE-type containing 21 2 8
MIRT102284 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 4
MIRT107595 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 6
MIRT178618 HIAT1 major facilitator superfamily domain containing 14A 2 2
MIRT182407 TIPRL TOR signaling pathway regulator 2 4
MIRT186552 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT273662 HOXC8 homeobox C8 2 2
MIRT283191 C16ORF52 chromosome 16 open reading frame 52 2 2
MIRT284890 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT347670 LSM14A LSM14A, mRNA processing body assembly factor 2 2
MIRT400222 SLC35F6 solute carrier family 35 member F6 2 2
MIRT403517 ASPH aspartate beta-hydroxylase 2 2
MIRT442251 DCTN5 dynactin subunit 5 2 2
MIRT443023 SDR39U1 short chain dehydrogenase/reductase family 39U member 1 2 2
MIRT443097 RNF20 ring finger protein 20 2 2
MIRT444560 TRA2B transformer 2 beta homolog 2 2
MIRT445696 PRKG1 protein kinase, cGMP-dependent, type I 2 2
MIRT454084 TMEM209 transmembrane protein 209 2 2
MIRT455463 LYPLA2 lysophospholipase II 2 2
MIRT456653 TIFA TRAF interacting protein with forkhead associated domain 2 2
MIRT458147 LYRM4 LYR motif containing 4 2 6
MIRT467073 SRRD SRR1 domain containing 2 4
MIRT467245 SPPL2A signal peptide peptidase like 2A 2 2
MIRT468246 SFXN4 sideroflexin 4 2 2
MIRT471589 PAQR5 progestin and adipoQ receptor family member 5 2 19
MIRT476639 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT482433 ADM adrenomedullin 2 10
MIRT486848 PERP PERP, TP53 apoptosis effector 2 6
MIRT489656 SHMT1 serine hydroxymethyltransferase 1 2 2
MIRT493441 KANSL1 KAT8 regulatory NSL complex subunit 1 2 6
MIRT493841 FOXN3 forkhead box N3 2 4
MIRT501378 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT509679 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510280 MED28 mediator complex subunit 28 2 2
MIRT512221 ATXN3 ataxin 3 2 6
MIRT514030 BNIP2 BCL2 interacting protein 2 2 2
MIRT521375 RDX radixin 2 4
MIRT521444 RAD51 RAD51 recombinase 2 2
MIRT526055 CBR1 carbonyl reductase 1 2 2
MIRT528658 FUNDC2 FUN14 domain containing 2 2 2
MIRT529975 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT544098 IPMK inositol polyphosphate multikinase 2 2
MIRT545579 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 2 2
MIRT547424 MED4 mediator complex subunit 4 2 2
MIRT548955 CD2AP CD2 associated protein 2 2
MIRT549537 NDUFA6 NADH:ubiquinone oxidoreductase subunit A6 2 4
MIRT552550 ZFP36L2 ZFP36 ring finger protein like 2 2 4
MIRT554640 ROBO1 roundabout guidance receptor 1 2 2
MIRT564904 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT565578 SLC6A8 solute carrier family 6 member 8 2 2
MIRT568312 BAG4 BCL2 associated athanogene 4 2 2
MIRT617891 PTCHD3 patched domain containing 3 2 2
MIRT621892 TAF13 TATA-box binding protein associated factor 13 2 2
MIRT642850 RNF135 ring finger protein 135 2 2
MIRT665395 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT697879 UBE2B ubiquitin conjugating enzyme E2 B 2 2
MIRT698492 THOC2 THO complex 2 2 2
MIRT701227 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT701872 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT707045 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT715216 NPVF neuropeptide VF precursor 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-921 Progesterone approved 5994 Microarray Breast cancer 22330642 2012 up-regulated
miR-921 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-921 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-mir-921 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-921 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-921 Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-mir-921 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-miR-921 Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-921 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-921 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-921 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-921 Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-921 Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-921 Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-921 Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-921 Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-921 Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-921 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR1)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission