miRTarBase - #MIRT715696


—
pre-miRNA Information
pre-miRNA hsa-mir-6509   
Genomic Coordinates chr7: 135206994 - 135207078
Description Homo sapiens miR-6509 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6509-3p
Sequence 52| UUCCACUGCCACUACCUAAUUU |73
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs778601614 1 dbSNP
rs754554776 3 dbSNP
rs767798995 3 dbSNP
rs145322812 4 dbSNP
rs773941257 5 dbSNP
rs768273593 9 dbSNP
rs984565062 12 dbSNP
rs748872915 13 dbSNP
rs774861125 14 dbSNP
rs13241975 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PNMAL2
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_124B_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + B
Location of target site ENST00000599531.1 | 3UTR | UGGAGCUGACCCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
82 hsa-miR-6509-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055374 PDCD4 programmed cell death 4 2 4
MIRT378341 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT444668 CDKL2 cyclin dependent kinase like 2 2 2
MIRT446953 CD248 CD248 molecule 2 2
MIRT460332 CAMK4 calcium/calmodulin dependent protein kinase IV 2 6
MIRT464078 VPS4A vacuolar protein sorting 4 homolog A 2 2
MIRT464586 UBN2 ubinuclein 2 2 2
MIRT468482 SESN3 sestrin 3 2 2
MIRT468962 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT475455 HSPA8 heat shock protein family A (Hsp70) member 8 2 2
MIRT482403 ADRB1 adrenoceptor beta 1 2 10
MIRT486992 ZFAND2B zinc finger AN1-type containing 2B 2 2
MIRT489397 TUBB2A tubulin beta 2A class IIa 2 2
MIRT526319 UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus 2 2
MIRT526560 UGT2A2 UDP glucuronosyltransferase family 2 member A2 2 2
MIRT526732 ZNF138 zinc finger protein 138 2 8
MIRT531581 STXBP5L syntaxin binding protein 5 like 2 2
MIRT532011 NOX5 NADPH oxidase 5 2 2
MIRT533407 TXLNG taxilin gamma 2 2
MIRT533436 TRPC5 transient receptor potential cation channel subfamily C member 5 2 2
MIRT533866 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT539254 ANKRD50 ankyrin repeat domain 50 2 2
MIRT541451 C15orf48 chromosome 15 open reading frame 48 2 2
MIRT566794 MIER3 MIER family member 3 2 2
MIRT569294 SURF6 surfeit 6 2 2
MIRT571336 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT572802 PPP3CB protein phosphatase 3 catalytic subunit beta 2 2
MIRT572813 MYO1C myosin IC 2 2
MIRT574219 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT607259 GRAMD1B GRAM domain containing 1B 2 4
MIRT609307 CHD4 chromodomain helicase DNA binding protein 4 2 2
MIRT615459 REPS1 RALBP1 associated Eps domain containing 1 2 2
MIRT616861 RPLP1 ribosomal protein lateral stalk subunit P1 2 2
MIRT619415 NOS1AP nitric oxide synthase 1 adaptor protein 2 2
MIRT619652 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT625325 TNFRSF13B TNF receptor superfamily member 13B 2 2
MIRT638980 ARFIP2 ADP ribosylation factor interacting protein 2 2 2
MIRT639458 ZNF429 zinc finger protein 429 2 2
MIRT640550 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT641473 B4GALNT3 beta-1,4-N-acetyl-galactosaminyltransferase 3 2 2
MIRT642720 ATXN3 ataxin 3 2 2
MIRT643048 SMN1 survival of motor neuron 1, telomeric 2 2
MIRT644921 SMN2 survival of motor neuron 2, centromeric 2 2
MIRT645875 ZNF275 zinc finger protein 275 2 2
MIRT649824 LIPG lipase G, endothelial type 2 2
MIRT649851 GYS2 glycogen synthase 2 2 2
MIRT649972 TRAFD1 TRAF-type zinc finger domain containing 1 2 2
MIRT650675 ZNF259 ZPR1 zinc finger 1 1
MIRT651319 ZCCHC2 zinc finger CCHC-type containing 2 2 2
MIRT652876 TAB1 TGF-beta activated kinase 1 (MAP3K7) binding protein 1 2 2
MIRT652881 SYVN1 synoviolin 1 2 2
MIRT654144 RPAP2 RNA polymerase II associated protein 2 2 2
MIRT657080 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT657181 INO80C INO80 complex subunit C 2 2
MIRT657830 GJD3 gap junction protein delta 3 2 2
MIRT657897 GDF7 growth differentiation factor 7 2 2
MIRT659631 CDKN2AIP CDKN2A interacting protein 2 2
MIRT663115 SPTA1 spectrin alpha, erythrocytic 1 2 2
MIRT664739 METTL16 methyltransferase like 16 2 2
MIRT667551 LRAT lecithin retinol acyltransferase 2 2
MIRT668552 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT682893 XIAP X-linked inhibitor of apoptosis 2 2
MIRT683092 PRRG4 proline rich and Gla domain 4 2 2
MIRT683102 TIMM10B translocase of inner mitochondrial membrane 10B 2 2
MIRT697648 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT709158 ZNF419 zinc finger protein 419 2 2
MIRT713220 RCAN2 regulator of calcineurin 2 2 2
MIRT713277 LAIR1 leukocyte associated immunoglobulin like receptor 1 2 2
MIRT715008 CYP1B1 cytochrome P450 family 1 subfamily B member 1 2 2
MIRT715051 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT715696 PNMAL2 paraneoplastic Ma antigen family member 8B 2 2
MIRT717250 TMEM246 transmembrane protein 246 2 2
MIRT717322 PGK1 phosphoglycerate kinase 1 2 2
MIRT717587 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 2 2
MIRT718122 CHST4 carbohydrate sulfotransferase 4 2 2
MIRT718418 CALN1 calneuron 1 2 2
MIRT718750 ZNF490 zinc finger protein 490 2 2
MIRT720048 PPP1R3F protein phosphatase 1 regulatory subunit 3F 2 2
MIRT721497 THRB thyroid hormone receptor beta 2 2
MIRT722531 EPRS glutamyl-prolyl-tRNA synthetase 2 2
MIRT723279 KRTAP21-2 keratin associated protein 21-2 2 2
MIRT724813 MSX2 msh homeobox 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6509-3p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-6509-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6509-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6509-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6509-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission