miRTarBase - #MIRT716397


—
pre-miRNA Information
pre-miRNA hsa-mir-497   
Genomic Coordinates chr17: 7017911 - 7018022
Synonyms MIRN497, hsa-mir-497, MIR497
Description Homo sapiens miR-497 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-497-3p
Sequence 64| CAAACCACACUGUGGUGUUAGA |85
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 17 - 7017957 29233923 MiREDiBase
A-to-I 4 17 - 7017956 29233923 MiREDiBase
A-to-I 20 17 - 7017940 24964909, 25521855, 27229138, 29165639, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1413601274 5 dbSNP
rs1028648384 6 dbSNP
rs1479092960 9 dbSNP
rs1261056598 10 dbSNP
rs997278260 11 dbSNP
rs1324708562 13 dbSNP
rs755634302 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NPAS1   
Synonyms MOP5, PASD5, bHLHe11
Description neuronal PAS domain protein 1
Transcript NM_002517   
Expression
Putative miRNA Targets on NPAS1
3'UTR of NPAS1
(miRNA target sites are highlighted)		 
>NPAS1|NM_002517|3'UTR
   1 GGACTGGCAGAGCTGCCGGCGCCGGACCCTGCGACAACCGGGGTCCCCCAGGACAGTAGGCCCGGCTCTGCCCGTAGCCC
  81 TGAGAATTAAACGCCGGCTCTCCCTGCAGTGGTTTGGGCTCCGGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agauuGUGGUGUCACACCAAAc 5'
               | |::||  ||||||| 
Target 5' gctctCCCTGCA--GTGGTTTg 3'
 97 - 116 149.00 -14.90
2 
miRNA  3' agauuGUGGUG-UCACACCAaac 5'
               ::| || |  | |||   
Target 5' gacccTGCGACAACCGGGGTccc 3'
 25 - 47 73.00 -15.00
3 
miRNA  3' agauuguggugucacACCaaac 5'
                         |||    
Target 5' -----------ggacTGGcaga 3'
 1 - 11 60.00 -6.01
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs987481567 3 dbSNP
rs933149064 15 dbSNP
rs1216722227 23 dbSNP
rs1052988705 29 dbSNP
rs1226433308 30 dbSNP
rs1266318085 32 dbSNP
rs1296652823 33 dbSNP
rs1271251410 36 dbSNP
rs911871617 38 dbSNP
rs1307438529 40 dbSNP
rs1217398972 43 dbSNP
rs940652875 47 dbSNP
rs1450518323 48 dbSNP
rs182950880 53 dbSNP
rs1337510195 56 dbSNP
rs1201544558 60 dbSNP
rs1450382865 61 dbSNP
rs369741405 66 dbSNP
rs111796936 70 dbSNP
rs1352987748 72 dbSNP
rs1168040949 74 dbSNP
rs899238316 75 dbSNP
rs1409223092 78 dbSNP
rs1420102432 78 dbSNP
rs930509406 81 dbSNP
rs1442726958 85 dbSNP
rs552909436 93 dbSNP
rs894393081 96 dbSNP
rs1484021630 97 dbSNP
rs1230890663 100 dbSNP
rs1001238131 102 dbSNP
rs79174199 105 dbSNP
rs1277242406 110 dbSNP
rs959805884 119 dbSNP
rs1359360210 123 dbSNP
rs1023945104 124 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agauuguggugucacACCAAAc 5'
                         |||||| 
Target 5' ---------------UGGUUUg 3'
 		1 - 7
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_124B_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + B
Location of target site ENST00000439365.2 | 3UTR | UGGUUUGGGCUCCGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla -0.709 3.3e-3 -0.567 2.2e-2 13 Click to see details
GSE32688 Pancreatic cancer -0.375 1.7e-2 -0.456 4.4e-3 32 Click to see details
GSE19350 CNS germ cell tumors 0.524 4.0e-2 0.392 1.0e-1 12 Click to see details
GSE26953 Aortic valvular endothelial cells -0.289 8.5e-2 -0.284 8.9e-2 24 Click to see details
GSE21687 Ependynoma primary tumors -0.16 1.0e-1 -0.157 1.1e-1 64 Click to see details
GSE42095 Differentiated embryonic stem cells 0.078 3.6e-1 0.112 3.1e-1 23 Click to see details
GSE28544 Breast cancer -0.074 3.7e-1 -0.009 4.8e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.059 3.9e-1 0.042 4.2e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.042 4.3e-1 0.173 2.3e-1 20 Click to see details
GSE38226 Liver fibrosis 0.037 4.4e-1 0.197 2.0e-1 21 Click to see details
GSE17498 Multiple myeloma 0.011 4.7e-1 0.060 3.6e-1 40 Click to see details
GSE17498 Multiple myeloma 0.011 4.7e-1 0.060 3.6e-1 40 Click to see details
GSE17498 Multiple myeloma 0.011 4.7e-1 0.060 3.6e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.498 0.01 0.377 0.05 21 Click to see details
CHOL -0.854 0.02 -0.886 0.01 6 Click to see details
BLCA -0.968 0.02 -1.000 0.5 4 Click to see details
HNSC -0.416 0.04 -0.496 0.02 18 Click to see details
LUSC 0.295 0.06 0.376 0.02 30 Click to see details
BRCA -0.225 0.08 -0.194 0.11 42 Click to see details
LUAD 0.819 0.09 0.200 0.4 4 Click to see details
UCEC -0.331 0.11 -0.282 0.14 16 Click to see details
THCA -0.177 0.12 -0.228 0.07 45 Click to see details
PAAD 0.741 0.13 0.400 0.3 4 Click to see details
KICH 0.29 0.15 0.039 0.45 15 Click to see details
ESCA -0.367 0.15 -0.103 0.39 10 Click to see details
PRAD -0.15 0.16 -0.109 0.24 46 Click to see details
KIRP 0.179 0.22 0.236 0.15 21 Click to see details
KIRC 0.093 0.28 0.071 0.33 43 Click to see details
LIHC -0.098 0.3 -0.003 0.49 30 Click to see details
LIHC -0.098 0.3 -0.003 0.49 30 Click to see details
LIHC -0.098 0.3 -0.003 0.49 30 Click to see details
LIHC -0.098 0.3 -0.003 0.49 30 Click to see details
95 hsa-miR-497-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT092955 CYP2U1 cytochrome P450 family 2 subfamily U member 1 2 4
MIRT124568 PRRC2B proline rich coiled-coil 2B 2 2
MIRT125196 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 4
MIRT147296 KPNA2 karyopherin subunit alpha 2 2 8
MIRT163999 KIAA1109 KIAA1109 2 4
MIRT252495 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT357969 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT443007 TRIOBP TRIO and F-actin binding protein 2 2
MIRT443524 NETO1 neuropilin and tolloid like 1 2 2
MIRT443573 EVX2 even-skipped homeobox 2 2 2
MIRT443656 BACH1 BTB domain and CNC homolog 1 2 2
MIRT460670 KRT10 keratin 10 2 8
MIRT464761 UBE2N ubiquitin conjugating enzyme E2 N 2 2
MIRT465032 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT465040 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT468667 SEC62 SEC62 homolog, preprotein translocation factor 2 2
MIRT473694 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT477618 EFNA3 ephrin A3 2 2
MIRT480506 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT480592 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT486915 ZNF398 zinc finger protein 398 2 6
MIRT487770 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 16
MIRT493265 MDFIC MyoD family inhibitor domain containing 2 2
MIRT495271 SLC1A2 solute carrier family 1 member 2 2 4
MIRT495309 CHST12 carbohydrate sulfotransferase 12 2 2
MIRT496681 DPP6 dipeptidyl peptidase like 6 2 4
MIRT496891 FOXP1 forkhead box P1 2 2
MIRT497330 IRF4 interferon regulatory factor 4 2 2
MIRT498272 KIAA1644 KIAA1644 2 2
MIRT498634 CHD4 chromodomain helicase DNA binding protein 4 2 10
MIRT500581 USP53 ubiquitin specific peptidase 53 2 2
MIRT500751 TMPPE transmembrane protein with metallophosphoesterase domain 2 6
MIRT509668 ZNF354B zinc finger protein 354B 2 10
MIRT510919 PSMA2 proteasome subunit alpha 2 2 4
MIRT519118 CEP76 centrosomal protein 76 2 2
MIRT526193 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 2 2
MIRT526746 HLA-DOB major histocompatibility complex, class II, DO beta 2 2
MIRT527270 FBLN2 fibulin 2 2 2
MIRT528198 PLEKHM2 pleckstrin homology and RUN domain containing M2 2 2
MIRT528330 TBC1D22B TBC1 domain family member 22B 2 2
MIRT530346 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 2 2
MIRT533627 TMX3 thioredoxin related transmembrane protein 3 2 2
MIRT533738 TMEM200C transmembrane protein 200C 2 2
MIRT533779 TMEM133 transmembrane protein 133 2 2
MIRT534317 SKIDA1 SKI/DACH domain containing 1 2 2
MIRT538438 COG5 component of oligomeric golgi complex 5 2 2
MIRT539156 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT539474 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT539620 SHISA9 shisa family member 9 2 2
MIRT539650 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 2 2
MIRT540346 OPHN1 oligophrenin 1 2 2
MIRT540412 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 2 2
MIRT541200 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT541395 CDC27 cell division cycle 27 2 2
MIRT546443 SNX5 sorting nexin 5 2 2
MIRT547369 MSI2 musashi RNA binding protein 2 2 2
MIRT553288 TSPAN3 tetraspanin 3 2 2
MIRT554402 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT557822 FOXN2 forkhead box N2 2 2
MIRT568530 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT569508 THYN1 thymocyte nuclear protein 1 2 2
MIRT570707 FAM69A family with sequence similarity 69 member A 2 2
MIRT608376 PIWIL2 piwi like RNA-mediated gene silencing 2 2 2
MIRT608483 NKTR natural killer cell triggering receptor 2 6
MIRT613533 TRA2B transformer 2 beta homolog 2 2
MIRT616601 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT618166 DUSP18 dual specificity phosphatase 18 2 2
MIRT632059 CEP135 centrosomal protein 135 2 2
MIRT647379 ZDHHC23 zinc finger DHHC-type containing 23 2 2
MIRT648366 POTED POTE ankyrin domain family member D 2 2
MIRT651075 ZNF518B zinc finger protein 518B 2 4
MIRT653618 SLC30A4 solute carrier family 30 member 4 2 2
MIRT653636 SLC30A1 solute carrier family 30 member 1 2 2
MIRT654895 POU2F1 POU class 2 homeobox 1 2 2
MIRT656232 MFSD6 major facilitator superfamily domain containing 6 2 2
MIRT659880 CAPRIN1 cell cycle associated protein 1 2 2
MIRT660526 ARL4C ADP ribosylation factor like GTPase 4C 2 2
MIRT666286 SLC30A3 solute carrier family 30 member 3 2 2
MIRT686808 SNX2 sorting nexin 2 2 4
MIRT695302 TK1 thymidine kinase 1 2 2
MIRT699737 SERINC3 serine incorporator 3 2 2
MIRT700794 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT712270 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT712617 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT714264 RPL10A ribosomal protein L10a 2 2
MIRT715072 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT715386 TADA3 transcriptional adaptor 3 2 2
MIRT716397 NPAS1 neuronal PAS domain protein 1 2 2
MIRT725328 NFASC neurofascin 2 2
MIRT725503 GANAB glucosidase II alpha subunit 2 2
MIRT732913 IRAK2 interleukin 1 receptor associated kinase 2 3 0
MIRT734890 SMAD3 SMAD family member 3 3 0
MIRT737328 LINC02476 long intergenic non-protein coding RNA 2476 3 0
MIRT737544 MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) 4 0
MIRT755545 PAK1 p21 (RAC1) activated kinase 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-497 Bufalin NULL 9547215 Quantitative real-time PCR colorectal cancer HCT116 cells 24375248 2014 up-regulated
miR-497 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 up-regulated
miR-497 Ethanol NULL 702 Quantitative real-time PCR CIE10 22141737 2012 up-regulated
miR-497 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-497 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-497 Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7, T47D)
hsa-mir-497 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-497 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-497 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-mir-497 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-497 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-497 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-497 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-497-3p Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (BT-20, BT-474, BT-549, CAMA-1, HCC1143, HCC1395, HCC1569, HCC1806, HCC-1937, HCC1954, HCC202, HCC38, HCC70, Hs578T, MCF-7, MDA-MB-175VII, MDA-MB-231, MDA-MB-361, MDA-MB-415, MDA-MB-436, MDA-MB-468, SKBR3, T47D, UACC812, EVSA-T, MPE-600 , SK-BR-
hsa-miR-497-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549, PC-9)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-497-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-497-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant tissue
hsa-miR-497-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission