pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6787 |
Genomic Coordinates | chr17: 82236668 - 82236728 |
Description | Homo sapiens miR-6787 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6787-5p | ||||||||||||||||||||||||||||||||||||
Sequence | 6| UGGCGGGGGUAGAGCUGGCUGC |27 | ||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||
Experiments | Meta-analysis | ||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | HRNR | ||||||||||||||||||||
Synonyms | FLG3, S100A16, S100a18 | ||||||||||||||||||||
Description | hornerin | ||||||||||||||||||||
Transcript | NM_001009931 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on HRNR | |||||||||||||||||||||
3'UTR of HRNR (miRNA target sites are highlighted) |
>HRNR|NM_001009931|3'UTR 1 ATAATAAACATAAATGCAATTTACTCAAGTAGCAATTTAAGAAATAGGAAAGTCATCTATGAATTCATCATGAAAGACAA 81 GCAATCCATCATGAAATTCGTTCTAAAAGTGAATCAATGCATTTCTGTCTCTTTCTTTAGAGCCTAAAACTGTAGCATAT 161 ATCTTGTTATGGGGTTCCTTCCAAAGACTGTTAGGCATTTGTGCTACTTTGTTAGAAAATACTGAGTGGAATAACTTGTT 241 AGAATGAGGGTTAAACTTTGAGGAATAATGAAAAGCTTTTAAAGAGCTTTGGGTTTAGTTGGAGTTGTCTTTTTGAGAGC 321 TCATCATTCATTTATAGATGGTGCCAAAGCTAACCTTACATTTCTTAGAAGCAAAATATTACAAATGCATTACCAGTCCT 401 AGATACAAAGCTTTGTTTTACAGCAATTAGTGTACCCTAATTTTTAGTGTGCCCCAAGTTTGGTGTGTCCCAATTTTTGG 481 TATTGTGGCAGAAGGTGAAGGCTCTGAAAGCAAAGATGCAGCAGCGGTAGTGTCTTTACTTATCAAAACCATCAAGTCCT 561 TTTTCTTGGGTATATATTTAATCAGTAAGTTAATTAGTGGCATAAAAAAGTAGCATCAGGGTCTTTTCCCAAGCCAGTGA 641 GCAAGAGCATTATTTCATAAAGAATAGGGATTTATCATTTCAGGAAAAAAAAAAACATTCAAATGTGGGCTTTAGCTTGT 721 TTTCAGCAGAAAGATCTTGCTCCCTATTTCTAAGAGGCTGCTCAATATTGGGAAATATATTGAGGAGTTATTCCATGGAA 801 ATACAATGCTTTCCACCTACTACTGTAGTTCAATAACGTTTCCACCTGAAAAAATATCATCCATGCCCAGATGAAAAGGA 881 AGAGTATCTGTCACTGCTACATAGTTCCTTAATTTGACTGTAACACATTTGTTTCAAGTCTTTGGATTCAAACAACCGGA 961 TTGTATTAAAATTGACAATAAATAAATGTTGATTAAATAC Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HeLa | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
CLIP-seq Support 1 for dataset Chi_124B_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + B |
Location of target site | ENST00000368704.1 | 3UTR | GCCUGAUGCCCCGCC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
90 hsa-miR-6787-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT449091 | XPO6 | exportin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449991 | PSMG1 | proteasome assembly chaperone 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454608 | MYADM | myeloid associated differentiation marker | ![]() |
![]() |
2 | 2 | ||||||
MIRT456116 | VAV3 | vav guanine nucleotide exchange factor 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT457064 | TOR4A | torsin family 4 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT461023 | SDF4 | stromal cell derived factor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467197 | SPRY4 | sprouty RTK signaling antagonist 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471711 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472566 | NACC1 | nucleus accumbens associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476079 | GRB2 | growth factor receptor bound protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480150 | CALR | calreticulin | ![]() |
![]() |
2 | 2 | ||||||
MIRT483027 | KHSRP | KH-type splicing regulatory protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT483498 | STMN3 | stathmin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT483728 | THSD4 | thrombospondin type 1 domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484550 | BARHL1 | BarH like homeobox 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT484684 | PACSIN1 | protein kinase C and casein kinase substrate in neurons 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486059 | CTDNEP1 | CTD nuclear envelope phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486116 | INO80E | INO80 complex subunit E | ![]() |
![]() |
2 | 2 | ||||||
MIRT486313 | SIPA1 | signal-induced proliferation-associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486525 | CLCN7 | chloride voltage-gated channel 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486857 | DPF1 | double PHD fingers 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487352 | PHF15 | jade family PHD finger 2 | ![]() |
1 | 1 | |||||||
MIRT487582 | FAM83H | family with sequence similarity 83 member H | ![]() |
![]() |
2 | 4 | ||||||
MIRT487792 | GPR20 | G protein-coupled receptor 20 | ![]() |
![]() |
2 | 4 | ||||||
MIRT488104 | POU3F1 | POU class 3 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT488786 | POFUT2 | protein O-fucosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489361 | SYNGR1 | synaptogyrin 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489387 | RAB11B | RAB11B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT489680 | SCAMP4 | secretory carrier membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489731 | GNAI2 | G protein subunit alpha i2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489750 | TACC3 | transforming acidic coiled-coil containing protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490029 | PCSK4 | proprotein convertase subtilisin/kexin type 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490379 | LHFPL3 | LHFPL tetraspan subfamily member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490580 | SLC47A1 | solute carrier family 47 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490753 | SRCIN1 | SRC kinase signaling inhibitor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491187 | JUND | JunD proto-oncogene, AP-1 transcription factor subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT491301 | VGF | VGF nerve growth factor inducible | ![]() |
![]() |
2 | 2 | ||||||
MIRT491462 | HOXB8 | homeobox B8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491702 | PDZD4 | PDZ domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491724 | RTN4R | reticulon 4 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT491737 | SEMA3F | semaphorin 3F | ![]() |
![]() |
2 | 2 | ||||||
MIRT491984 | UNK | unkempt family zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT492844 | NRGN | neurogranin | ![]() |
![]() |
2 | 2 | ||||||
MIRT492936 | NEUROD2 | neuronal differentiation 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT493713 | H2AFX | H2A histone family member X | ![]() |
![]() |
2 | 2 | ||||||
MIRT494623 | ASB6 | ankyrin repeat and SOCS box containing 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT494703 | ARHGAP31 | Rho GTPase activating protein 31 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495602 | NKX2-5 | NK2 homeobox 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495750 | PDE4C | phosphodiesterase 4C | ![]() |
![]() |
2 | 4 | ||||||
MIRT500367 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 2 | ||||||
MIRT501161 | SLC10A7 | solute carrier family 10 member 7 | ![]() |
![]() |
2 | 6 | ||||||
MIRT501702 | PCGF3 | polycomb group ring finger 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT504922 | PDRG1 | p53 and DNA damage regulated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517945 | TRIM59 | tripartite motif containing 59 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524212 | DDI2 | DNA damage inducible 1 homolog 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT531186 | SIGLEC12 | sialic acid binding Ig like lectin 12 (gene/pseudogene) | ![]() |
![]() |
2 | 2 | ||||||
MIRT531972 | C12orf49 | chromosome 12 open reading frame 49 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558055 | EVI5L | ecotropic viral integration site 5 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT560482 | LACE1 | AFG1 like ATPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT563217 | FXN | frataxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT569095 | FSCN1 | fascin actin-bundling protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569522 | AP5Z1 | adaptor related protein complex 5 zeta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT569531 | CTTN | cortactin | ![]() |
![]() |
2 | 2 | ||||||
MIRT569848 | RGS5 | regulator of G protein signaling 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570738 | ANKRD52 | ankyrin repeat domain 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574140 | MARVELD1 | MARVEL domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615994 | DHTKD1 | dehydrogenase E1 and transketolase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628493 | ZNF556 | zinc finger protein 556 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633451 | KLLN | killin, p53-regulated DNA replication inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT649054 | SLC1A2 | solute carrier family 1 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649340 | HEXA | hexosaminidase subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT670226 | PTCHD1 | patched domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670666 | KIAA1551 | KIAA1551 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671452 | CDH7 | cadherin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671729 | ZNF451 | zinc finger protein 451 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690285 | ZNF154 | zinc finger protein 154 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700575 | PRSS22 | protease, serine 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701411 | NKRF | NFKB repressing factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT711877 | VASP | vasodilator stimulated phosphoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT712082 | UNC13A | unc-13 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT712523 | CYTH2 | cytohesin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712751 | GMDS | GDP-mannose 4,6-dehydratase | ![]() |
![]() |
2 | 2 | ||||||
MIRT714681 | PRX | periaxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT714718 | VPS8 | VPS8, CORVET complex subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT717508 | HRNR | hornerin | ![]() |
![]() |
2 | 2 | ||||||
MIRT717650 | THBS2 | thrombospondin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719592 | PIAS4 | protein inhibitor of activated STAT 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720521 | PTGR2 | prostaglandin reductase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721295 | C3orf36 | chromosome 3 open reading frame 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724922 | VPS18 | VPS18, CORVET/HOPS core subunit | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|