pre-miRNA Information
pre-miRNA hsa-mir-4436b-1   
Genomic Coordinates chr2: 110086433 - 110086523
Description Homo sapiens miR-4436b-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-4436b-2   
Genomic Coordinates chr2: 110284853 - 110284943
Description Homo sapiens miR-4436b-2 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4436b-3p
Sequence 60| CAGGGCAGGAAGAAGUGGACAA |81
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760150076 9 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LCE1A   
Synonyms LEP1
Description late cornified envelope 1A
Transcript NM_178348   
Expression
Putative miRNA Targets on LCE1A
3'UTR of LCE1A
(miRNA target sites are highlighted)
>LCE1A|NM_178348|3'UTR
   1 AGCGGACTCTGCACCTAGAAGAGCAGACTCGGGTGAAATGAGTGATCAAACATTTCCTCCTCACCTGTCTCCTCCTGGGC
  81 CTGCAAGAGTGGCTGAGATGCCCGCGTGAAGGCTCTGAGCTCTGGCCTAGAGGATCCCTCTGCCCTGGGATCCAGAAACT
 161 TGATTCTTCTCCCACAAACCTATCTGCTGCCCCTGACACCAACTGTGTTGTCTACTCTGGGATCCCAAGCCACAAACTCA
 241 CTCTCCAGCTCATTTCCTGCAGCCTCAAGTGAAACAATAAAGCAAAAGATCT
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' aacaggugaAGAAGGACGGGAc 5'
                   ||  :||||||| 
Target 5' cctagaggaTCCCTCTGCCCTg 3'
126 - 147 145.00 -17.20
2
miRNA  3' aacAGGUGAAG--AAGGACG--GGAc 5'
             ||||  ||  |||||||  ||| 
Target 5' ctcTCCAGCTCATTTCCTGCAGCCTc 3'
241 - 266 129.00 -15.80
3
miRNA  3' aacaggUGAAGA-AGGACGGGac 5'
                || | | | ||||||  
Target 5' ccacaaACCTATCTGCTGCCCct 3'
172 - 194 128.00 -14.30
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs377377563 4 dbSNP
rs202240825 5 dbSNP
rs1323016703 6 dbSNP
rs1311586372 7 dbSNP
rs1024844618 9 dbSNP
rs560219195 11 dbSNP
rs1284319356 16 dbSNP
rs761057878 18 dbSNP
rs1217193971 19 dbSNP
rs764571011 21 dbSNP
rs1339692806 23 dbSNP
rs776917542 24 dbSNP
rs762090826 26 dbSNP
rs750496811 31 dbSNP
rs376228410 32 dbSNP
rs1017068687 33 dbSNP
rs990091888 34 dbSNP
rs182383649 36 dbSNP
rs767400621 40 dbSNP
rs752635467 44 dbSNP
rs962970624 45 dbSNP
rs914473700 49 dbSNP
rs1314899573 50 dbSNP
rs1208248561 52 dbSNP
rs115638937 54 dbSNP
rs1025885349 57 dbSNP
rs1216848086 60 dbSNP
rs1360417630 67 dbSNP
rs75174223 68 dbSNP
rs1415849341 74 dbSNP
rs531617240 79 dbSNP
rs1357737690 96 dbSNP
rs986474382 100 dbSNP
rs910999048 104 dbSNP
rs942423293 105 dbSNP
rs551414710 106 dbSNP
rs925088804 107 dbSNP
rs187873436 110 dbSNP
rs117752402 113 dbSNP
rs1482694165 116 dbSNP
rs1251392036 119 dbSNP
rs896399762 130 dbSNP
rs919448583 140 dbSNP
rs929452235 142 dbSNP
rs1234408060 143 dbSNP
rs547428816 151 dbSNP
rs1049789459 153 dbSNP
rs1291769062 159 dbSNP
rs567373424 160 dbSNP
rs373077545 167 dbSNP
rs950134453 170 dbSNP
rs1045694251 175 dbSNP
rs868082905 181 dbSNP
rs1359821425 183 dbSNP
rs888001461 187 dbSNP
rs756298293 190 dbSNP
rs1353987754 194 dbSNP
rs1169924690 197 dbSNP
rs1461856464 199 dbSNP
rs1296006604 201 dbSNP
rs1311452080 209 dbSNP
rs1162453083 210 dbSNP
rs147349784 220 dbSNP
rs1039074683 222 dbSNP
rs1178559118 226 dbSNP
rs1024846058 227 dbSNP
rs1017135177 236 dbSNP
rs556212625 238 dbSNP
rs898690754 253 dbSNP
rs569704630 255 dbSNP
rs1337513024 260 dbSNP
rs1271666162 261 dbSNP
rs538512461 262 dbSNP
rs1244601798 270 dbSNP
rs78134937 272 dbSNP
rs1309483774 273 dbSNP
rs578090570 278 dbSNP
rs1222247200 283 dbSNP
rs1025934363 290 dbSNP
rs1207576870 292 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_178348 | 3UTR | GGAUCCCUCUGCCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset Chi_124B_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + B
Location of target site ENST00000335123.2 | 3UTR | CUGGGAUCCAGAAACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
87 hsa-miR-4436b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066957 ATXN7L3B ataxin 7 like 3B 2 8
MIRT119284 NABP1 nucleic acid binding protein 1 2 6
MIRT128915 KMT2A lysine methyltransferase 2A 2 2
MIRT150116 MIDN midnolin 2 2
MIRT173040 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT253117 BCL2L12 BCL2 like 12 2 2
MIRT256997 RGMB repulsive guidance molecule family member b 2 2
MIRT259746 SNX12 sorting nexin 12 2 2
MIRT267278 TMEM109 transmembrane protein 109 2 2
MIRT441934 C1orf109 chromosome 1 open reading frame 109 2 2
MIRT443625 CPSF2 cleavage and polyadenylation specific factor 2 2 2
MIRT445757 AGO1 argonaute 1, RISC catalytic component 2 2
MIRT447835 CTIF cap binding complex dependent translation initiation factor 2 2
MIRT451230 ZNF444 zinc finger protein 444 2 2
MIRT451966 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT453127 HOXC4 homeobox C4 2 2
MIRT454604 RPL13A ribosomal protein L13a 2 2
MIRT455176 SUV39H1 suppressor of variegation 3-9 homolog 1 2 2
MIRT455547 GJB1 gap junction protein beta 1 2 2
MIRT458197 ATP6V0A2 ATPase H+ transporting V0 subunit a2 2 2
MIRT458356 NOC2L NOC2 like nucleolar associated transcriptional repressor 2 2
MIRT458923 DNM2 dynamin 2 2 2
MIRT461013 SYT7 synaptotagmin 7 2 2
MIRT461643 ZSWIM4 zinc finger SWIM-type containing 4 2 2
MIRT461997 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT462367 BCL7B BCL tumor suppressor 7B 2 2
MIRT464915 TXNIP thioredoxin interacting protein 2 2
MIRT466311 TIMM22 translocase of inner mitochondrial membrane 22 2 2
MIRT466591 TBC1D2B TBC1 domain family member 2B 2 2
MIRT467045 SRSF1 serine and arginine rich splicing factor 1 2 2
MIRT468750 SDC2 syndecan 2 2 2
MIRT468943 RPS24 ribosomal protein S24 2 2
MIRT469474 REEP5 receptor accessory protein 5 2 2
MIRT469913 PTRF caveolae associated protein 1 2 2
MIRT473325 MEX3A mex-3 RNA binding family member A 2 2
MIRT473643 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT474064 LMNB2 lamin B2 2 2
MIRT474357 KMT2D lysine methyltransferase 2D 2 2
MIRT475394 ICMT isoprenylcysteine carboxyl methyltransferase 2 4
MIRT476335 GLTSCR1L BRD4 interacting chromatin remodeling complex associated protein like 2 2
MIRT478651 CTDNEP1 CTD nuclear envelope phosphatase 1 2 2
MIRT479585 CDC42SE1 CDC42 small effector 1 2 2
MIRT479943 CBX5 chromobox 5 2 2
MIRT482001 AMOTL2 angiomotin like 2 2 2
MIRT482043 AMER1 APC membrane recruitment protein 1 2 2
MIRT483070 EXT2 exostosin glycosyltransferase 2 2 6
MIRT484323 KCNH1 potassium voltage-gated channel subfamily H member 1 2 4
MIRT487528 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT489636 ALS2CL ALS2 C-terminal like 2 2
MIRT490693 SSTR1 somatostatin receptor 1 2 2
MIRT490871 UPK2 uroplakin 2 2 2
MIRT492582 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT492945 NEUROD2 neuronal differentiation 2 2 2
MIRT498675 SOD2 superoxide dismutase 2 2 4
MIRT499349 RAB25 RAB25, member RAS oncogene family 2 2
MIRT502338 GIGYF1 GRB10 interacting GYF protein 1 2 4
MIRT502976 CCNL1 cyclin L1 2 8
MIRT503706 NUP62 nucleoporin 62 2 2
MIRT505567 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 2 2
MIRT507808 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT513242 FBXO41 F-box protein 41 2 6
MIRT513586 EVX1 even-skipped homeobox 1 2 2
MIRT525036 FRK fyn related Src family tyrosine kinase 2 2
MIRT531035 TDGF1P3 teratocarcinoma-derived growth factor 1 pseudogene 3 2 2
MIRT531939 RBMS2 RNA binding motif single stranded interacting protein 2 2 2
MIRT534912 PUM2 pumilio RNA binding family member 2 2 2
MIRT535717 N4BP1 NEDD4 binding protein 1 2 2
MIRT540498 ZMAT4 zinc finger matrin-type 4 2 4
MIRT541465 AURKA aurora kinase A 2 2
MIRT554328 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT561572 SLC6A9 solute carrier family 6 member 9 2 2
MIRT564715 ZNF322P1 zinc finger protein 322 pseudogene 1 2 2
MIRT576176 Hmox1 heme oxygenase 1 2 2
MIRT629712 XKR4 XK related 4 2 2
MIRT636182 THBD thrombomodulin 2 2
MIRT646315 MPHOSPH8 M-phase phosphoprotein 8 2 2
MIRT649174 IQSEC1 IQ motif and Sec7 domain 1 2 2
MIRT666945 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT684057 FOLR1 folate receptor 1 2 2
MIRT687585 MAU2 MAU2 sister chromatid cohesion factor 2 2
MIRT689953 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT704071 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT704327 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 2
MIRT705406 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT710488 CDH5 cadherin 5 2 2
MIRT718241 LCE1A late cornified envelope 1A 2 2
MIRT723182 CDCA4 cell division cycle associated 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4436b-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4436b-3p Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission