pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-500b |
Genomic Coordinates | chrX: 50010672 - 50010750 |
Description | Homo sapiens miR-500b stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||
---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-500b-3p | ||||||
Sequence | 51| GCACCCAGGCAAGGAUUCUG |70 | ||||||
Evidence | Experimental | ||||||
Experiments | Illumina | ||||||
SNPs in miRNA |
|
||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | MUC20 | ||||||||||||||||||||
Synonyms | MUC-20 | ||||||||||||||||||||
Description | mucin 20, cell surface associated | ||||||||||||||||||||
Transcript | NM_152673 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on MUC20 | |||||||||||||||||||||
3'UTR of MUC20 (miRNA target sites are highlighted) |
>MUC20|NM_152673|3'UTR 1 CGGACATCAGCTGCAGCCAGGCATGTCCCGTATGCCAAAAGAGGGTGCTGCCCCTAGCCTGGGCCCCCACCGACAGACTG 81 CAGCTGCGTTACTGTGCTGAGAGGTACCCAGAAGGTTCCCATGAAGGGCAGCATGTCCAAGCCCCTAACCCCAGATGTGG 161 CAACAGGACCCTCGCTCACATCCACCGGAGTGTATGTATGGGGAGGGGCTTCACCTGTTCCCAGAGGTGTCCTTGGACTC 241 ACCTTGGCACATGTTCTGTGTTTCAGTAAAGAGAGACCTGATCACCCATCTGTGTGCTTCCATCCTGCATTAAAATTCAC 321 TCAGTGTGGCCCAGAAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HeLa |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
CLIP-seq Support 1 for dataset Chi_124B_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + B |
Location of target site | ENST00000320736.6 | 3UTR | ACACGAAAAUUAGCUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
172 hsa-miR-500b-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT059905 | HDGF | heparin binding growth factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT235394 | KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT442246 | PYGO1 | pygopus family PHD finger 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443591 | ZNF439 | zinc finger protein 439 | ![]() |
![]() |
2 | 4 | ||||||
MIRT453280 | EFTUD2 | elongation factor Tu GTP binding domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463540 | ZBTB7A | zinc finger and BTB domain containing 7A | ![]() |
![]() |
2 | 2 | ||||||
MIRT465589 | TNRC6B | trinucleotide repeat containing 6B | ![]() |
![]() |
2 | 2 | ||||||
MIRT469462 | REL | REL proto-oncogene, NF-kB subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT485449 | KCTD15 | potassium channel tetramerization domain containing 15 | ![]() |
![]() |
2 | 4 | ||||||
MIRT486682 | WDR81 | WD repeat domain 81 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489078 | POLM | DNA polymerase mu | ![]() |
![]() |
2 | 2 | ||||||
MIRT493734 | GREM2 | gremlin 2, DAN family BMP antagonist | ![]() |
![]() |
2 | 2 | ||||||
MIRT494872 | DYNLL2 | dynein light chain LC8-type 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496130 | RNF103-CHMP3 | RNF103-CHMP3 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT496489 | CHMP3 | charged multivesicular body protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT496924 | CLMN | calmin | ![]() |
![]() |
2 | 2 | ||||||
MIRT497297 | TMEM119 | transmembrane protein 119 | ![]() |
![]() |
2 | 2 | ||||||
MIRT499103 | AGRN | agrin | ![]() |
![]() |
2 | 2 | ||||||
MIRT508979 | CXorf38 | chromosome X open reading frame 38 | ![]() |
![]() |
2 | 2 | ||||||
MIRT509911 | NIPAL1 | NIPA like domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT512820 | ARRDC2 | arrestin domain containing 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT512827 | KBTBD6 | kelch repeat and BTB domain containing 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT515360 | MRPL52 | mitochondrial ribosomal protein L52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT516610 | TRIM58 | tripartite motif containing 58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517053 | TLDC1 | TBC/LysM-associated domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517637 | ZNF491 | zinc finger protein 491 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518270 | LEAP2 | liver enriched antimicrobial peptide 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518625 | STAR | steroidogenic acute regulatory protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT518887 | N4BP2L2 | NEDD4 binding protein 2 like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT519026 | PAICS | phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT520365 | UBE2G2 | ubiquitin conjugating enzyme E2 G2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT521106 | SLC1A5 | solute carrier family 1 member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT521943 | PHC3 | polyhomeotic homolog 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522253 | NPEPPS | aminopeptidase puromycin sensitive | ![]() |
![]() |
2 | 2 | ||||||
MIRT522853 | KIAA1551 | KIAA1551 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522868 | KIAA1549 | KIAA1549 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524207 | DDX19B | DEAD-box helicase 19B | ![]() |
![]() |
2 | 2 | ||||||
MIRT526004 | ARHGAP27 | Rho GTPase activating protein 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527769 | RRAD | RRAD, Ras related glycolysis inhibitor and calcium channel regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT527827 | TMEM74B | transmembrane protein 74B | ![]() |
![]() |
2 | 2 | ||||||
MIRT527861 | SMOC1 | SPARC related modular calcium binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT528040 | WT1 | Wilms tumor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529802 | ZDHHC8 | zinc finger DHHC-type containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531723 | TARS | threonyl-tRNA synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT531996 | BARD1 | BRCA1 associated RING domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533338 | UNC119B | unc-119 lipid binding chaperone B | ![]() |
![]() |
2 | 2 | ||||||
MIRT533621 | TNFRSF13C | TNF receptor superfamily member 13C | ![]() |
![]() |
2 | 2 | ||||||
MIRT533652 | TMOD2 | tropomodulin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534397 | SENP3 | SUMO1/sentrin/SMT3 specific peptidase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538686 | CCDC80 | coiled-coil domain containing 80 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540444 | RBM43 | RNA binding motif protein 43 | ![]() |
![]() |
2 | 2 | ||||||
MIRT542586 | ZC3H12C | zinc finger CCCH-type containing 12C | ![]() |
![]() |
2 | 8 | ||||||
MIRT542796 | PLEKHA3 | pleckstrin homology domain containing A3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT542991 | ERC1 | ELKS/RAB6-interacting/CAST family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544424 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 4 | ||||||
MIRT545740 | ESF1 | ESF1 nucleolar pre-rRNA processing protein homolog | ![]() |
![]() |
2 | 4 | ||||||
MIRT552618 | ZBTB8A | zinc finger and BTB domain containing 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT554456 | SAMD8 | sterile alpha motif domain containing 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569663 | PRIM1 | DNA primase subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569924 | PCSK9 | proprotein convertase subtilisin/kexin type 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570140 | IL1RL2 | interleukin 1 receptor like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573558 | TMEM120B | transmembrane protein 120B | ![]() |
![]() |
2 | 2 | ||||||
MIRT574282 | OPRD1 | opioid receptor delta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575335 | Fbxo6 | F-box protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607057 | IDS | iduronate 2-sulfatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT607078 | POM121L7 | POM121 transmembrane nucleoporin like 7 pseudogene | ![]() |
![]() |
2 | 2 | ||||||
MIRT607500 | HEBP2 | heme binding protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607530 | ABL2 | ABL proto-oncogene 2, non-receptor tyrosine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT607808 | RHBDL2 | rhomboid like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT608079 | ZFP14 | ZFP14 zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT609119 | NUDT3 | nudix hydrolase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT609745 | PTCH1 | patched 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT612904 | HIF1AN | hypoxia inducible factor 1 alpha subunit inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT618720 | PCSK2 | proprotein convertase subtilisin/kexin type 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618778 | HLA-E | major histocompatibility complex, class I, E | ![]() |
![]() |
2 | 2 | ||||||
MIRT619015 | SLC2A6 | solute carrier family 2 member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT623223 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | ![]() |
![]() |
2 | 2 | ||||||
MIRT623819 | GEMIN6 | gem nuclear organelle associated protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT625704 | OPTN | optineurin | ![]() |
![]() |
2 | 2 | ||||||
MIRT626437 | CHDH | choline dehydrogenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT628087 | KAT7 | lysine acetyltransferase 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628936 | APOB | apolipoprotein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT633543 | PGBD5 | piggyBac transposable element derived 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634348 | SGOL1 | shugoshin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634611 | KIAA1919 | major facilitator superfamily domain containing 4B | ![]() |
![]() |
2 | 2 | ||||||
MIRT635243 | QPRT | quinolinate phosphoribosyltransferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT636681 | BTLA | B and T lymphocyte associated | ![]() |
![]() |
2 | 2 | ||||||
MIRT636923 | ZNF845 | zinc finger protein 845 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637606 | ZNF554 | zinc finger protein 554 | ![]() |
![]() |
2 | 2 | ||||||
MIRT639242 | RANGAP1 | Ran GTPase activating protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640835 | POLR3A | RNA polymerase III subunit A | ![]() |
![]() |
2 | 2 | ||||||
MIRT642098 | FBXL2 | F-box and leucine rich repeat protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643087 | PTPLAD2 | 3-hydroxyacyl-CoA dehydratase 4 | ![]() |
1 | 1 | |||||||
MIRT643934 | C17orf104 | meiosis specific with coiled-coil domain | ![]() |
![]() |
2 | 2 | ||||||
MIRT644353 | FXN | frataxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT645628 | SF3A3 | splicing factor 3a subunit 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT645754 | FAM213A | family with sequence similarity 213 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT646329 | MVB12B | multivesicular body subunit 12B | ![]() |
![]() |
2 | 2 | ||||||
MIRT646817 | COX19 | COX19, cytochrome c oxidase assembly factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT647019 | ADCY2 | adenylate cyclase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647621 | IGSF9B | immunoglobulin superfamily member 9B | ![]() |
![]() |
2 | 2 | ||||||
MIRT648517 | PIGG | phosphatidylinositol glycan anchor biosynthesis class G | ![]() |
![]() |
2 | 2 | ||||||
MIRT648871 | ABCA6 | ATP binding cassette subfamily A member 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649620 | ITPKC | inositol-trisphosphate 3-kinase C | ![]() |
![]() |
2 | 2 | ||||||
MIRT650062 | CCDC134 | coiled-coil domain containing 134 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650734 | TNFSF8 | TNF superfamily member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT652389 | TMEM55A | phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654352 | RBM27 | RNA binding motif protein 27 | ![]() |
![]() |
2 | 2 | ||||||
MIRT655796 | NOVA2 | NOVA alternative splicing regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657329 | HNRNPK | heterogeneous nuclear ribonucleoprotein K | ![]() |
![]() |
2 | 2 | ||||||
MIRT657734 | GOSR1 | golgi SNAP receptor complex member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT660613 | ANO6 | anoctamin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661243 | ARL17B | ADP ribosylation factor like GTPase 17B | ![]() |
![]() |
2 | 2 | ||||||
MIRT662245 | PGBD4 | piggyBac transposable element derived 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662921 | MED18 | mediator complex subunit 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662963 | JPH2 | junctophilin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663347 | ZNF74 | zinc finger protein 74 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663528 | MASTL | microtubule associated serine/threonine kinase like | ![]() |
![]() |
2 | 2 | ||||||
MIRT663547 | CCR6 | C-C motif chemokine receptor 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663977 | ZNF786 | zinc finger protein 786 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664084 | METTL2B | methyltransferase like 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT664358 | C16orf45 | chromosome 16 open reading frame 45 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664421 | TIGD6 | tigger transposable element derived 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664476 | ZYG11B | zyg-11 family member B, cell cycle regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT664979 | TDRD1 | tudor domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665128 | PYCRL | pyrroline-5-carboxylate reductase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666259 | SLC31A1 | solute carrier family 31 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666321 | SLC16A10 | solute carrier family 16 member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666881 | POLQ | DNA polymerase theta | ![]() |
![]() |
2 | 2 | ||||||
MIRT668469 | FADS6 | fatty acid desaturase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669554 | ALG14 | ALG14, UDP-N-acetylglucosaminyltransferase subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT669835 | ISCA2 | iron-sulfur cluster assembly 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670185 | CCDC142 | coiled-coil domain containing 142 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672020 | PXMP4 | peroxisomal membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672070 | KIAA0930 | KIAA0930 | ![]() |
![]() |
2 | 2 | ||||||
MIRT672475 | RTTN | rotatin | ![]() |
![]() |
2 | 2 | ||||||
MIRT672851 | ICOSLG | inducible T-cell costimulator ligand | ![]() |
![]() |
2 | 2 | ||||||
MIRT673090 | AK1 | adenylate kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT673581 | KDELC2 | KDEL motif containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674586 | SLC35B4 | solute carrier family 35 member B4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675001 | STRN3 | striatin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679018 | MTMR10 | myotubularin related protein 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT679680 | STAT3 | signal transducer and activator of transcription 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682833 | FLG2 | filaggrin family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT682886 | SAR1A | secretion associated Ras related GTPase 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT683442 | AP3B2 | adaptor related protein complex 3 beta 2 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT687040 | RNF115 | ring finger protein 115 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691957 | RHOH | ras homolog family member H | ![]() |
![]() |
2 | 2 | ||||||
MIRT694625 | ZFPM1 | zinc finger protein, FOG family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695637 | SLC26A2 | solute carrier family 26 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697640 | WRN | Werner syndrome RecQ like helicase | ![]() |
![]() |
2 | 2 | ||||||
MIRT702009 | MIDN | midnolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT702034 | MOGAT1 | monoacylglycerol O-acyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT704789 | CDK6 | cyclin dependent kinase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705728 | AMMECR1L | AMMECR1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT705879 | ADM | adrenomedullin | ![]() |
![]() |
2 | 2 | ||||||
MIRT706220 | ACOT9 | acyl-CoA thioesterase 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708418 | CERS4 | ceramide synthase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709114 | C3orf18 | chromosome 3 open reading frame 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709595 | ITPA | inosine triphosphatase | ![]() |
![]() |
2 | 2 | ||||||
MIRT710945 | MRPL45 | mitochondrial ribosomal protein L45 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712345 | NLN | neurolysin | ![]() |
![]() |
2 | 2 | ||||||
MIRT712530 | CYTH2 | cytohesin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT714019 | ASCC1 | activating signal cointegrator 1 complex subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717287 | ARMC12 | armadillo repeat containing 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717733 | FGF1 | fibroblast growth factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718083 | CLIC5 | chloride intracellular channel 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718562 | MUC20 | mucin 20, cell surface associated | ![]() |
![]() |
2 | 2 | ||||||
MIRT721639 | MYLK3 | myosin light chain kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722632 | C8A | complement C8 alpha chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT723177 | CDCA4 | cell division cycle associated 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725523 | FAM229B | family with sequence similarity 229 member B | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|