miRTarBase - #MIRT718602


—
pre-miRNA Information
pre-miRNA hsa-mir-378f   
Genomic Coordinates chr1: 23929070 - 23929147
Description Homo sapiens miR-378f stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-378f
Sequence 52| ACUGGACUUGGAGCCAGAAG |71
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 18 1 + 23929138 29233923 MiREDiBase
A-to-I 19 1 + 23929139 29233923 MiREDiBase
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DCTPP1   
Synonyms CDA03, RS21C6, XTP3TPA
Description dCTP pyrophosphatase 1
Transcript NM_024096   
Expression
Putative miRNA Targets on DCTPP1
3'UTR of DCTPP1
(miRNA target sites are highlighted)		 
>DCTPP1|NM_024096|3'UTR
   1 AAAGATGGCCACAGGACTTGCAACTCAGGGTGGTGTCTGAAGAGCAGAGAGTGGCCTGGCCCTGGAGCCTTTTTCTAGTC
  81 TTTTCAGAATAGATCATGGGCCTGAGGCCTCCACTTCTTGAGGTCTGAGGCCCAGCAGCCTCTAGAAGGTAGCCTCCTGG
 161 TGTTTGTTCTCCCAGTAAAATGGTTTTGGGCGATAACTTCTAGATTATTCCTGGATGGCCAGGGAGGCTCTCTGTCTCAG
 241 CAGGTGATGACGGGGGTACCAGGGGTGCCTCTGAGACCCATTCTCGTGTTTCCCTGTTGTACCTTTTGCCTGCAGGGCAG
 321 AGAGATCTGGTTTCTAGCAAATTCCCAGTAGGATGTCATGTAAGTTCCTTCCCCCTCTTAGAGATTGAAGGCTGTAAGAG
 401 TCCAGATGGTGGAGCCAGGCTGTCTGGGTTCAAATGCCATCTTTGACACTTGCAAGCTAAATGACATTACTCAAATTAAT
 481 CGTTCTGCACTTCAGCTTCCTTGTCTATCAAATAAAAAGAATAGTACCTGCCCAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaagaCCGAGGU--UCAGGUCa 5'
               |||| :|  ||||||| 
Target 5' ttgaaGGCTGTAAGAGTCCAGa 3'
 385 - 406 153.00 -17.30
2 
miRNA  3' gaaGACCG--AGGUUCAGGUca 5'
             | |||  ||:::||:||  
Target 5' agcCAGGCTGTCTGGGTTCAaa 3'
 413 - 434 107.00 -12.20
3 
miRNA  3' gaAGA---CCGAGGUUCAGGUCa 5'
            |||   ||: : |:| |||| 
Target 5' ctTCTTGAGGTCTGAGGCCCAGc 3'
 114 - 136 106.00 -14.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31605305 3 COSMIC
COSN8497561 4 COSMIC
COSN30493786 9 COSMIC
COSN19614658 21 COSMIC
COSN26359743 35 COSMIC
COSN31510052 54 COSMIC
COSN19717415 464 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1326219975 12 dbSNP
rs1269347306 13 dbSNP
rs1296649720 14 dbSNP
rs1215166932 19 dbSNP
rs767146033 20 dbSNP
rs759121826 21 dbSNP
rs899928083 26 dbSNP
rs1273225857 28 dbSNP
rs1227585965 29 dbSNP
rs773840691 30 dbSNP
rs770411229 32 dbSNP
rs200514967 33 dbSNP
rs1345211538 42 dbSNP
rs1478106108 43 dbSNP
rs1284331381 46 dbSNP
rs773332397 47 dbSNP
rs1162653297 53 dbSNP
rs575688547 54 dbSNP
rs1302932707 60 dbSNP
rs923029601 65 dbSNP
rs1406637722 68 dbSNP
rs1388955270 82 dbSNP
rs13337501 88 dbSNP
rs538484583 95 dbSNP
rs1399717935 107 dbSNP
rs1296740584 112 dbSNP
rs1342849377 129 dbSNP
rs940321683 148 dbSNP
rs571438951 153 dbSNP
rs553320349 161 dbSNP
rs1284177010 184 dbSNP
rs930121830 188 dbSNP
rs1230122382 190 dbSNP
rs1293507160 191 dbSNP
rs920140776 192 dbSNP
rs1214812068 203 dbSNP
rs534875333 204 dbSNP
rs958448702 213 dbSNP
rs1186718512 224 dbSNP
rs927043887 230 dbSNP
rs1181949353 234 dbSNP
rs981081188 239 dbSNP
rs567275733 243 dbSNP
rs57034532 244 dbSNP
rs1020202290 251 dbSNP
rs990618952 253 dbSNP
rs1401683019 254 dbSNP
rs1334028391 255 dbSNP
rs1339242554 257 dbSNP
rs1450220031 260 dbSNP
rs960747912 263 dbSNP
rs1035084426 272 dbSNP
rs530519271 285 dbSNP
rs1433611595 286 dbSNP
rs569687552 292 dbSNP
rs1311794964 294 dbSNP
rs957431908 300 dbSNP
rs1032804101 307 dbSNP
rs996417433 312 dbSNP
rs1191704825 320 dbSNP
rs1204300242 323 dbSNP
rs966667212 334 dbSNP
rs1022751260 346 dbSNP
rs1437331114 353 dbSNP
rs1458983171 358 dbSNP
rs1258155229 359 dbSNP
rs1011154157 367 dbSNP
rs1197519555 372 dbSNP
rs551437915 374 dbSNP
rs1257433615 384 dbSNP
rs1233491231 385 dbSNP
rs1049893889 387 dbSNP
rs998374600 400 dbSNP
rs1338016931 410 dbSNP
rs1399607180 416 dbSNP
rs532620827 417 dbSNP
rs901366165 418 dbSNP
rs1444698799 434 dbSNP
rs142511988 439 dbSNP
rs1336590459 443 dbSNP
rs181729372 454 dbSNP
rs1379839795 468 dbSNP
rs1008164037 470 dbSNP
rs907535262 474 dbSNP
rs111795097 481 dbSNP
rs1049210038 482 dbSNP
rs373825833 486 dbSNP
rs1332625806 492 dbSNP
rs898751631 495 dbSNP
rs766836481 496 dbSNP
rs930540916 499 dbSNP
rs1450682957 505 dbSNP
rs927013161 511 dbSNP
rs1481648867 519 dbSNP
rs916495866 521 dbSNP
rs1177738206 524 dbSNP
rs1423563774 527 dbSNP
rs1464073967 529 dbSNP
rs1299971287 531 dbSNP
rs867738270 534 dbSNP
rs949694141 542 dbSNP
rs1174562280 543 dbSNP
rs1405363646 545 dbSNP
rs1277421328 553 dbSNP
rs139154873 554 dbSNP
rs1376863347 563 dbSNP
rs528805096 569 dbSNP
rs1251371726 576 dbSNP
rs1355101448 577 dbSNP
rs927830977 578 dbSNP
rs1171457080 601 dbSNP
rs978140639 603 dbSNP
rs1207670459 604 dbSNP
rs1269066304 607 dbSNP
rs561235686 618 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaagACCGAGGUUCAGGUCa 5'
              |||  : :|| |||| 
Target 5' -agaUGG--UGGAG-CCAGg 3'
 		1 - 16
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_124B_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + B
Location of target site ENST00000319285.4 | 3UTR | AGAUGGUGGAGCCAGGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
27 hsa-miR-378f Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT463100 ZNF609 zinc finger protein 609 2 2
MIRT469371 REST RE1 silencing transcription factor 2 6
MIRT495441 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT513606 VPS37B VPS37B, ESCRT-I subunit 2 2
MIRT520414 TXNL1 thioredoxin like 1 2 4
MIRT525111 PRKD2 protein kinase D2 2 2
MIRT525979 SPA17 sperm autoantigenic protein 17 2 2
MIRT527002 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT529215 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT529835 ARGFX arginine-fifty homeobox 2 2
MIRT532300 HAUS3 HAUS augmin like complex subunit 3 2 2
MIRT537577 ESYT2 extended synaptotagmin 2 2 2
MIRT543140 AKT1 AKT serine/threonine kinase 1 2 2
MIRT554924 RAP1B RAP1B, member of RAS oncogene family 2 2
MIRT564970 WTAP WT1 associated protein 2 2
MIRT570115 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT652734 TGFB2 transforming growth factor beta 2 2 2
MIRT655948 NDST1 N-deacetylase and N-sulfotransferase 1 2 2
MIRT655997 MYRF myelin regulatory factor 2 2
MIRT684875 P4HB prolyl 4-hydroxylase subunit beta 2 2
MIRT692969 LGSN lengsin, lens protein with glutamine synthetase domain 2 2
MIRT693737 ACACA acetyl-CoA carboxylase alpha 2 2
MIRT710991 PPARGC1B PPARG coactivator 1 beta 2 2
MIRT712247 RCC2 regulator of chromosome condensation 2 2 2
MIRT718602 DCTPP1 dCTP pyrophosphatase 1 2 2
MIRT723499 WDR33 WD repeat domain 33 2 2
MIRT725448 HIPK3 homeodomain interacting protein kinase 3 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-378f Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378f Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378f Doxorubicin 31703 NSC123127 approved sensitive High Triple-Negative Breast Cancer cell line (MDA-MB-231, MDA-MB-468)
hsa-miR-378f Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-378f Erlotinib 176870 NSC718781 approved resistant High Head And Neck Squamous Cell Carcinoma cell line (HN6)
hsa-mir-378f Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-miR-378f Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-378f Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-378f Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-378f Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-378f Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-378f Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)

Error report submission