| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-8067 |
| Genomic Coordinates | chr15: 62304658 - 62304734 |
| Description | Homo sapiens miR-8067 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-8067 | |||||||||||||||
| Sequence | 11| CCUAGAAACUGUAAACUUAGUC |32 | |||||||||||||||
| Evidence | Experimental | |||||||||||||||
| Experiments | Illumina | |||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||
| Putative Targets | ||||||||||||||||
| Gene Information | |
|---|---|
| Gene Symbol | PPP1R3E |
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HeLa |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
| Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
| CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | HeLa / HeLa cell miR-124 + A |
| Location of target site | ENST00000452015.4 | 3UTR | AGAAGAGAGAAGGAGGA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
68 hsa-miR-8067 Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT084581 | BCL2L11 | BCL2 like 11 |  |
|
2 | 4 | ||||||
| MIRT088215 | NUP50 | nucleoporin 50 | |
|
2 | 2 | ||||||
| MIRT092085 | ABHD5 | abhydrolase domain containing 5 | |
|
2 | 2 | ||||||
| MIRT135269 | TMBIM6 | transmembrane BAX inhibitor motif containing 6 | |
|
2 | 8 | ||||||
| MIRT175259 | PSAT1 | phosphoserine aminotransferase 1 | |
|
2 | 6 | ||||||
| MIRT182508 | KLHL20 | kelch like family member 20 | |
|
2 | 2 | ||||||
| MIRT286224 | TMEM97 | transmembrane protein 97 | |
|
2 | 4 | ||||||
| MIRT301718 | TEF | TEF, PAR bZIP transcription factor | |
|
2 | 2 | ||||||
| MIRT329381 | CCNG1 | cyclin G1 | |
|
2 | 2 | ||||||
| MIRT362146 | MTRNR2L6 | MT-RNR2-like 6 | |
|
2 | 4 | ||||||
| MIRT366561 | EIF2S3 | eukaryotic translation initiation factor 2 subunit gamma | |
|
2 | 2 | ||||||
| MIRT442002 | NDUFV3 | NADH:ubiquinone oxidoreductase subunit V3 | |
|
2 | 2 | ||||||
| MIRT442039 | TRPV2 | transient receptor potential cation channel subfamily V member 2 | |
|
2 | 2 | ||||||
| MIRT443045 | HPS4 | HPS4, biogenesis of lysosomal organelles complex 3 subunit 2 | |
|
2 | 2 | ||||||
| MIRT446861 | SAMD9L | sterile alpha motif domain containing 9 like | |
|
2 | 2 | ||||||
| MIRT450346 | LHFPL3 | LHFPL tetraspan subfamily member 3 | |
|
2 | 2 | ||||||
| MIRT454306 | ZNF134 | zinc finger protein 134 | |
|
2 | 2 | ||||||
| MIRT481951 | ANKRD11 | ankyrin repeat domain 11 | |
|
2 | 2 | ||||||
| MIRT484816 | ZNFX1 | zinc finger NFX1-type containing 1 | |
|
2 | 2 | ||||||
| MIRT497596 | EBAG9 | estrogen receptor binding site associated, antigen, 9 | |
|
2 | 2 | ||||||
| MIRT498620 | MTRNR2L10 | MT-RNR2-like 10 | |
|
2 | 12 | ||||||
| MIRT501852 | MTRNR2L8 | MT-RNR2-like 8 | |
|
2 | 15 | ||||||
| MIRT502628 | DDX3X | DEAD-box helicase 3, X-linked | |
|
2 | 8 | ||||||
| MIRT503298 | GTF2A1 | general transcription factor IIA subunit 1 | |
|
2 | 6 | ||||||
| MIRT506789 | KLHL15 | kelch like family member 15 | |
|
2 | 6 | ||||||
| MIRT515069 | PLA2G2C | phospholipase A2 group IIC | |
|
2 | 2 | ||||||
| MIRT521334 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | |
|
2 | 2 | ||||||
| MIRT523692 | FHL2 | four and a half LIM domains 2 | |
|
2 | 4 | ||||||
| MIRT524416 | CNOT6L | CCR4-NOT transcription complex subunit 6 like | |
|
2 | 4 | ||||||
| MIRT525526 | FSIP2 | fibrous sheath interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT525771 | SOD2 | superoxide dismutase 2 | |
|
2 | 2 | ||||||
| MIRT526262 | CCDC169 | coiled-coil domain containing 169 | |
|
2 | 2 | ||||||
| MIRT526545 | MDM2 | MDM2 proto-oncogene | |
|
2 | 2 | ||||||
| MIRT527522 | CD59 | CD59 molecule (CD59 blood group) | |
|
2 | 2 | ||||||
| MIRT530875 | TRUB1 | TruB pseudouridine synthase family member 1 | |
|
2 | 4 | ||||||
| MIRT532991 | ZKSCAN8 | zinc finger with KRAB and SCAN domains 8 | |
|
2 | 2 | ||||||
| MIRT535581 | NUP35 | nucleoporin 35 | |
|
2 | 2 | ||||||
| MIRT536922 | HEPHL1 | hephaestin like 1 | |
|
2 | 2 | ||||||
| MIRT540004 | NT5DC3 | 5'-nucleotidase domain containing 3 | |
|
2 | 2 | ||||||
| MIRT540779 | SCO1 | SCO1, cytochrome c oxidase assembly protein | |
|
2 | 2 | ||||||
| MIRT541006 | ZNF136 | zinc finger protein 136 | |
|
2 | 2 | ||||||
| MIRT542072 | ASS1 | argininosuccinate synthase 1 | |
|
2 | 6 | ||||||
| MIRT544103 | IPMK | inositol polyphosphate multikinase | |
|
2 | 2 | ||||||
| MIRT547669 | KPNA1 | karyopherin subunit alpha 1 | |
|
2 | 4 | ||||||
| MIRT549914 | MRPS30 | mitochondrial ribosomal protein S30 | |
|
2 | 2 | ||||||
| MIRT551741 | HIST1H2BD | histone cluster 1 H2B family member d | |
|
2 | 2 | ||||||
| MIRT556374 | LUZP1 | leucine zipper protein 1 | |
|
2 | 2 | ||||||
| MIRT557320 | HIC2 | HIC ZBTB transcriptional repressor 2 | |
|
2 | 2 | ||||||
| MIRT561442 | TOB2 | transducer of ERBB2, 2 | |
|
2 | 2 | ||||||
| MIRT563938 | TAF7 | TATA-box binding protein associated factor 7 | |
|
2 | 2 | ||||||
| MIRT622315 | SEH1L | SEH1 like nucleoporin | |
|
2 | 2 | ||||||
| MIRT622334 | SEC63 | SEC63 homolog, protein translocation regulator | |
|
2 | 2 | ||||||
| MIRT627928 | KANSL1 | KAT8 regulatory NSL complex subunit 1 | |
|
2 | 2 | ||||||
| MIRT636122 | YPEL1 | yippee like 1 | |
|
2 | 2 | ||||||
| MIRT644871 | C2orf48 | chromosome 2 open reading frame 48 | |
|
2 | 2 | ||||||
| MIRT645105 | LANCL3 | LanC like 3 | |
|
2 | 2 | ||||||
| MIRT650430 | BBS9 | Bardet-Biedl syndrome 9 | |
|
2 | 2 | ||||||
| MIRT653330 | SMIM18 | small integral membrane protein 18 | |
|
2 | 2 | ||||||
| MIRT658101 | FOXN3 | forkhead box N3 | |
|
2 | 2 | ||||||
| MIRT690032 | CCDC90B | coiled-coil domain containing 90B | |
|
2 | 2 | ||||||
| MIRT697283 | ZNF800 | zinc finger protein 800 | |
|
2 | 2 | ||||||
| MIRT700266 | RAP2B | RAP2B, member of RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT700310 | RABGEF1 | RAB guanine nucleotide exchange factor 1 | |
|
2 | 2 | ||||||
| MIRT705431 | ATP11A | ATPase phospholipid transporting 11A | |
|
2 | 2 | ||||||
| MIRT706193 | MED24 | mediator complex subunit 24 | |
|
2 | 2 | ||||||
| MIRT707928 | PPP1R3D | protein phosphatase 1 regulatory subunit 3D | |
|
2 | 2 | ||||||
| MIRT716123 | RPL24 | ribosomal protein L24 | |
|
2 | 2 | ||||||
| MIRT720940 | PPP1R3E | protein phosphatase 1 regulatory subunit 3E | |
|
2 | 2 | ||||||