pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-758 |
Genomic Coordinates | chr14: 101026020 - 101026107 |
Synonyms | MIRN758, hsa-mir-758, MIR758 |
Description | Homo sapiens miR-758 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-758-5p | |||||||||||||||||||||||||||||||||||||||||||||
Sequence | 15| GAUGGUUGACCAGAGAGCACAC |36 | |||||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | |||||||||||||||||||||||||||||||||||||||||||||
Experiments | SOLiD | |||||||||||||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TSPAN1 | ||||||||||||||||||||
Synonyms | NET1, TM4C, TM4SF | ||||||||||||||||||||
Description | tetraspanin 1 | ||||||||||||||||||||
Transcript | NM_005727 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on TSPAN1 | |||||||||||||||||||||
3'UTR of TSPAN1 (miRNA target sites are highlighted) |
>TSPAN1|NM_005727|3'UTR 1 GTCCACTTCTGCCTCTGCCACTACTGCTGCCACATGGGAACTGTGAAGAGGCACCCTGGCAAGCAGCAGTGATTGGGGGA 81 GGGGACAGGATCTAACAATGTCACTTGGGCCAGAATGGACCTGCCCTTTCTGCTCCAGACTTGGGGCTAGATAGGGACCA 161 CTCCTTTTAGGCGATGCCTGACTTTCCTTCCATTGGTGGGTGGATGGGTGGGGGGCATTCCAGAGCCTCTAAGGTAGCCA 241 GTTCTGTTGCCCATTCCCCCAGTCTATTAAACCCTTGATATGCCCCCTAGGCCTAGTGGTGATCCCAGTGCTCTACTGGG 321 GGATGAGAGAAAGGCATTTTATAGCCTGGGCATAAGTGAAATCAGCAGAGCCTCTGGGTGGATGTGTAGAAGGCACTTCA 401 AAATGCATAAACCTGTTACAATGTTGCCAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HeLa |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A
... - Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature. |
Article |
- Chi SW; Zang JB; Mele A; Darnell RB - Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
|
CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50 | |
---|---|
Method / RBP | HITS-CLIP / AGO |
Cell line / Condition | HeLa / HeLa cell miR-124 + A |
Location of target site | ENST00000355029.4 | 3UTR | CUUGGAAAACAAACC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 19536157 / Chi_HITSCLIP |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
62 hsa-miR-758-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT085323 | MORC3 | MORC family CW-type zinc finger 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT089441 | STAMBP | STAM binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT089456 | TET3 | tet methylcytosine dioxygenase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT111856 | CCND1 | cyclin D1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT184933 | ZNF268 | zinc finger protein 268 | ![]() |
![]() |
2 | 2 | ||||||
MIRT215288 | CREBRF | CREB3 regulatory factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT237300 | LPP | LIM domain containing preferred translocation partner in lipoma | ![]() |
![]() |
2 | 2 | ||||||
MIRT238446 | MYO10 | myosin X | ![]() |
![]() |
2 | 4 | ||||||
MIRT273827 | RPL41 | ribosomal protein L41 | ![]() |
![]() |
2 | 2 | ||||||
MIRT282703 | HOOK1 | hook microtubule tethering protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT347970 | ZNF850 | zinc finger protein 850 | ![]() |
![]() |
2 | 2 | ||||||
MIRT371076 | KLF3 | Kruppel like factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464339 | USP6NL | USP6 N-terminal like | ![]() |
![]() |
2 | 2 | ||||||
MIRT470034 | PTP4A1 | protein tyrosine phosphatase type IVA, member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT477506 | ELL2 | elongation factor for RNA polymerase II 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482886 | CACNA2D3 | calcium voltage-gated channel auxiliary subunit alpha2delta 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492606 | POLR3E | RNA polymerase III subunit E | ![]() |
![]() |
2 | 2 | ||||||
MIRT502294 | GNG12 | G protein subunit gamma 12 | ![]() |
![]() |
2 | 6 | ||||||
MIRT507600 | DCTN4 | dynactin subunit 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT510728 | SON | SON DNA binding protein | ![]() |
![]() |
2 | 6 | ||||||
MIRT514065 | KCNJ6 | potassium voltage-gated channel subfamily J member 6 | ![]() |
![]() |
2 | 8 | ||||||
MIRT519718 | ZNF512B | zinc finger protein 512B | ![]() |
![]() |
2 | 4 | ||||||
MIRT520890 | STRN | striatin | ![]() |
![]() |
2 | 2 | ||||||
MIRT521760 | PPIL1 | peptidylprolyl isomerase like 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT526874 | ERCC8 | ERCC excision repair 8, CSA ubiquitin ligase complex subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT530232 | WSB2 | WD repeat and SOCS box containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT532003 | ACTR2 | ARP2 actin related protein 2 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT533371 | UBE2D4 | ubiquitin conjugating enzyme E2 D4 (putative) | ![]() |
![]() |
2 | 4 | ||||||
MIRT547106 | PIGW | phosphatidylinositol glycan anchor biosynthesis class W | ![]() |
![]() |
2 | 2 | ||||||
MIRT548189 | FOXA1 | forkhead box A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552935 | VKORC1L1 | vitamin K epoxide reductase complex subunit 1 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560085 | ZNF195 | zinc finger protein 195 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561726 | PPP2CA | protein phosphatase 2 catalytic subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT562713 | ZNF415 | zinc finger protein 415 | ![]() |
![]() |
2 | 2 | ||||||
MIRT562761 | ZNF846 | zinc finger protein 846 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564159 | ZNF117 | zinc finger protein 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565673 | SETD5 | SET domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT565718 | SESN3 | sestrin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566026 | RFX1 | regulatory factor X1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569048 | ZNF655 | zinc finger protein 655 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570367 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570410 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT570443 | TMEM189 | transmembrane protein 189 | ![]() |
![]() |
2 | 2 | ||||||
MIRT571738 | RNF11 | ring finger protein 11 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575042 | Tpgs2 | tubulin polyglutamylase complex subunit 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT614330 | ZDHHC22 | zinc finger DHHC-type containing 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617629 | RAB3IP | RAB3A interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT621667 | UBE4B | ubiquitination factor E4B | ![]() |
![]() |
2 | 2 | ||||||
MIRT639906 | SRGAP2 | SLIT-ROBO Rho GTPase activating protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651436 | XRCC5 | X-ray repair cross complementing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683853 | ZNF208 | zinc finger protein 208 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684841 | TPGS2 | tubulin polyglutamylase complex subunit 2 | ![]() |
![]() |
2 | 5 | ||||||
MIRT689347 | ZNF83 | zinc finger protein 83 | ![]() |
![]() |
2 | 2 | ||||||
MIRT692492 | SPIN4 | spindlin family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695711 | OLA1 | Obg like ATPase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT698219 | TMEM248 | transmembrane protein 248 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711560 | FAM20B | FAM20B, glycosaminoglycan xylosylkinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT712867 | TMEM67 | transmembrane protein 67 | ![]() |
![]() |
2 | 2 | ||||||
MIRT722956 | TSPAN1 | tetraspanin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT723622 | SOBP | sine oculis binding protein homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT724176 | ABCF2 | ATP binding cassette subfamily F member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT755363 | LMBR1 | limb development membrane protein 1 | 3 | 1 |
miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|