pre-miRNA Information
pre-miRNA hsa-mir-1245a   
Genomic Coordinates chr2: 188978092 - 188978161
Description Homo sapiens miR-1245a stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1245a
Sequence 45| AAGUGAUCUAAAGGCCUACAU |65
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31562560 15 COSMIC
COSN26581044 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs906938680 2 dbSNP
rs1159117523 3 dbSNP
rs780486044 6 dbSNP
rs771479866 17 dbSNP
rs1002976932 18 dbSNP
rs1428029219 19 dbSNP
Putative Targets

Gene Information
Gene Symbol MOGAT1   
Synonyms DGAT2L, DGAT2L1, MGAT1
Description monoacylglycerol O-acyltransferase 1
Transcript NM_058165   
Expression
Putative miRNA Targets on MOGAT1
3'UTR of MOGAT1
(miRNA target sites are highlighted)
>MOGAT1|NM_058165|3'UTR
   1 CTTGACTATAAAAAAAAATTAAAAAATAAAAATAAATGAC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31562503 4 COSMIC
COSN30170033 7 COSMIC
COSN28857268 8 COSMIC
COSN31505575 9 COSMIC
COSN20068700 19 COSMIC
COSN31579711 27 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1386940845 2 dbSNP
rs781270626 3 dbSNP
rs1032951265 5 dbSNP
rs746048377 6 dbSNP
rs1235089358 7 dbSNP
rs756366422 9 dbSNP
rs200261124 10 dbSNP
rs778992239 10 dbSNP
rs552710800 11 dbSNP
rs749721684 15 dbSNP
rs1481186970 20 dbSNP
rs1176567777 22 dbSNP
rs746169104 26 dbSNP
rs566547762 30 dbSNP
rs1464008489 41 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + A
Location of target site ENST00000333055.3 | 3UTR | UUCAGGAGUUUGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.332 0.23 0.554 0.1 7 Click to see details
BRCA -0.721 0.24 -0.500 0.33 3 Click to see details
UCEC 0.287 0.41 0.500 0.33 3 Click to see details
UCEC 0.287 0.41 0.500 0.33 3 Click to see details
UCEC 0.287 0.41 0.500 0.33 3 Click to see details
UCEC 0.287 0.41 0.500 0.33 3 Click to see details
UCEC 0.287 0.41 0.500 0.33 3 Click to see details
UCEC 0.287 0.41 0.500 0.33 3 Click to see details
109 hsa-miR-1245a Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT006574 BRCA2 BRCA2, DNA repair associated 2 1
MIRT055432 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT063879 RASSF8 Ras association domain family member 8 2 6
MIRT077025 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT095775 GRPEL2 GrpE like 2, mitochondrial 2 10
MIRT099172 MAP3K4 mitogen-activated protein kinase kinase kinase 4 2 2
MIRT175616 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT456518 LYPLAL1 lysophospholipase like 1 2 2
MIRT464457 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT465747 TMPPE transmembrane protein with metallophosphoesterase domain 2 2
MIRT468257 SFXN4 sideroflexin 4 2 2
MIRT469216 RICTOR RPTOR independent companion of MTOR complex 2 2 2
MIRT472045 NPAT nuclear protein, coactivator of histone transcription 2 2
MIRT481795 APEX1 apurinic/apyrimidinic endodeoxyribonuclease 1 2 2
MIRT500154 CREBBP CREB binding protein 2 2
MIRT506514 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 4
MIRT506915 KBTBD8 kelch repeat and BTB domain containing 8 2 6
MIRT513901 GRB10 growth factor receptor bound protein 10 2 6
MIRT519128 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 2 2
MIRT528121 FOXH1 forkhead box H1 2 2
MIRT528942 SFMBT2 Scm like with four mbt domains 2 2 2
MIRT540580 CEP89 centrosomal protein 89 2 2
MIRT545858 ZNF264 zinc finger protein 264 2 4
MIRT547147 PGM3 phosphoglucomutase 3 2 2
MIRT547434 MED4 mediator complex subunit 4 2 2
MIRT554650 ROBO1 roundabout guidance receptor 1 2 2
MIRT558524 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT559762 ABHD5 abhydrolase domain containing 5 2 2
MIRT560438 GOLGA7B golgin A7 family member B 2 2
MIRT561974 LRRC59 leucine rich repeat containing 59 2 2
MIRT562442 DDIT4 DNA damage inducible transcript 4 2 2
MIRT563489 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT568265 BMP2K BMP2 inducible kinase 2 2
MIRT572522 KIAA0232 KIAA0232 2 2
MIRT612801 LSM14A LSM14A, mRNA processing body assembly factor 2 2
MIRT621533 ZNF507 zinc finger protein 507 2 2
MIRT625205 GSTCD glutathione S-transferase C-terminal domain containing 2 2
MIRT625615 ZNF84 zinc finger protein 84 2 2
MIRT629215 C12orf66 chromosome 12 open reading frame 66 2 2
MIRT629509 AS3MT arsenite methyltransferase 2 2
MIRT629769 STK25 serine/threonine kinase 25 2 2
MIRT630908 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT632508 RAB13 RAB13, member RAS oncogene family 2 2
MIRT636871 ARSE arylsulfatase E (chondrodysplasia punctata 1) 2 2
MIRT637106 CXorf23 BCLAF1 and THRAP3 family member 3 2 2
MIRT637332 FAM9B family with sequence similarity 9 member B 2 2
MIRT637553 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT637639 ZNF431 zinc finger protein 431 2 2
MIRT637836 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT638326 RNF11 ring finger protein 11 2 2
MIRT638393 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT642450 CLUAP1 clusterin associated protein 1 2 2
MIRT642616 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT643133 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT644324 NFKBID NFKB inhibitor delta 2 2
MIRT645150 DIS3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 2
MIRT645673 ADK adenosine kinase 2 2
MIRT646091 MGST3 microsomal glutathione S-transferase 3 2 2
MIRT646858 SLC35E4 solute carrier family 35 member E4 2 2
MIRT650153 ZNF426 zinc finger protein 426 2 2
MIRT652483 TMEM181 transmembrane protein 181 2 2
MIRT653790 SIRPA signal regulatory protein alpha 2 2
MIRT655526 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 2
MIRT657077 JPH2 junctophilin 2 2 2
MIRT657322 HOOK3 hook microtubule tethering protein 3 2 2
MIRT662036 FUT2 fucosyltransferase 2 2 2
MIRT662322 ADM2 adrenomedullin 2 2 2
MIRT663211 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 2
MIRT663559 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663937 ZNF554 zinc finger protein 554 2 2
MIRT664689 EIF2B2 eukaryotic translation initiation factor 2B subunit beta 2 2
MIRT664709 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT665291 ZFP14 ZFP14 zinc finger protein 2 2
MIRT665572 TXNL1 thioredoxin like 1 2 2
MIRT667068 PAOX polyamine oxidase 2 2
MIRT667304 MYO5A myosin VA 2 2
MIRT667442 METTL14 methyltransferase like 14 2 2
MIRT668048 GTPBP10 GTP binding protein 10 2 2
MIRT669604 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT671088 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT674361 SLC35E3 solute carrier family 35 member E3 2 2
MIRT674962 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT676394 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT676819 AGMAT agmatinase 2 2
MIRT676891 ENSA endosulfine alpha 2 2
MIRT677059 ZNF34 zinc finger protein 34 2 2
MIRT678424 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678735 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT678930 XPOT exportin for tRNA 2 2
MIRT678954 MYADM myeloid associated differentiation marker 2 2
MIRT679228 MAN2A2 mannosidase alpha class 2A member 2 2 2
MIRT679765 TLR6 toll like receptor 6 2 2
MIRT681992 HRH4 histamine receptor H4 2 2
MIRT687405 NSUN4 NOP2/Sun RNA methyltransferase family member 4 2 2
MIRT694570 RBMXL1 RNA binding motif protein, X-linked like 1 2 2
MIRT698449 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT706406 HAS2 hyaluronan synthase 2 2 2
MIRT706582 ZNF432 zinc finger protein 432 2 2
MIRT706838 VHLL VHL like 2 2
MIRT706909 DVL3 dishevelled segment polarity protein 3 2 2
MIRT707052 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT708583 C11orf54 chromosome 11 open reading frame 54 2 2
MIRT708988 CABP4 calcium binding protein 4 2 2
MIRT713041 ADRA2B adrenoceptor alpha 2B 2 2
MIRT713731 SUCO SUN domain containing ossification factor 2 2
MIRT714968 RAB21 RAB21, member RAS oncogene family 2 2
MIRT717485 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT722826 KLK2 kallikrein related peptidase 2 2 2
MIRT723305 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1245a Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (500nM)
hsa-miR-1245a Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (500nM)
hsa-miR-1245a Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-1245a Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (M14) (1uM)
hsa-miR-1245a Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-1245a Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission