miRTarBase - #MIRT723787


—
pre-miRNA Information
pre-miRNA hsa-mir-629   
Genomic Coordinates chr15: 70079372 - 70079468
Synonyms MIRN629, hsa-mir-629, MIR629
Description Homo sapiens miR-629 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-629-3p
Sequence 61| GUUCUCCCAACGUAAGCCCAGC |82
Evidence Experimental
Experiments SAGE
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN26582616 16 COSMIC
COSN26958009 18 COSMIC
COSN8407437 22 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1242457085 1 dbSNP
rs1344122972 2 dbSNP
rs557636399 8 dbSNP
rs1233555233 9 dbSNP
rs377379255 10 dbSNP
rs756998503 11 dbSNP
rs753617436 12 dbSNP
rs1455005717 13 dbSNP
rs1363921181 14 dbSNP
rs373092208 19 dbSNP
rs755974356 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BKD83G miR-629 Safety Biomarker (SAF) Clinical/Experimental Data Expression Decrease Blood TaqMan OpenArray panels
Gene Information
Gene Symbol MUC17   
Synonyms MUC-17, MUC-3, MUC3
Description mucin 17, cell surface associated
Transcript NM_001040105   
Expression
Putative miRNA Targets on MUC17
3'UTR of MUC17
(miRNA target sites are highlighted)		 
>MUC17|NM_001040105|3'UTR
   1 GGCATGGAGCTGAGAAGTCTGGGAGTGAGGAGATCCCAGTCCGGCTAAGCTTGGTGGAGCATTTTCCCATTGAGAGCCTT
  81 CCATGGGAACTCAATGTTCCCATTGTAAGTACAGGAAACAAGCCCTGTACTTACCAAGGAGAAAGAGGAGAGACAGCAGT
 161 GCTGGGAGATTCTCAAATAGAAACCCGTGGACGCTCCAATGGGCTTGTCATGATATCAGGCTAGGCTTTCCTGCTCATTT
 241 TTCAAAGACGCTCCAGATTTGAGGGTACTCTGACTGCAACATCTTTCACCCCATTGATCGCCAGGATTGATTTGGTTGAT
 321 CTGGCTGAGCAGGCGGGTGTCCCCGTCCTCCCTCACTGCCCCATATGTGTCCCTCCTAAAGCTGCATGCTCAGTTGAAGA
 401 GGACGAGAGGACGACCTTCTCTGATAGAGGAGGACCACGCTTCAGTCAAAGGCATACAAGTATCTATCTGGACTTCCCTG
 481 CTAGCACTTCCAAACAAGCTCAGAGATGTTCCTCCCCTCATCTGCCCGGGTTCAGTACCATGGACAGCGCCCTCGACCCG
 561 CTGTTTACAACCATGACCCCTTGGACACTGGACTGCATGCACTTTACATATCACAAAATGCTCTCATAAGAATTATTGCA
 641 TACCATCTTCATGAAAAACACCTGTATTTAAATATAGAGCATTTACCTTTTGGTATATAAGATTGTGGGTATTTTTTAAG
 721 TTCTTATTGTTATGAGTTCTGATTTTTTCCTTAGTAAATATTATAATATATATTTGTAGTAACTAAAAATAATAAAGCAA
 801 TTTTATTACAATTTTAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgacccgaaUGCAACCCUCUug 5'
                   ::| |||||||  
Target 5' gagacagcaGTGCTGGGAGAtt 3'
 150 - 171 129.00 -11.80
2 
miRNA  3' cgACCCGAAUGCAACCCUCUUg 5'
            ||  |||||    |||||| 
Target 5' ccTGTACTTAC-CAAGGAGAAa 3'
 124 - 144 123.00 -13.60
3 
miRNA  3' cgACC-CGA--AUGCA-ACCCUCuug 5'
            ||| |||   | || ||||||   
Target 5' caTGGAGCTGAGAAGTCTGGGAGtga 3'
 3 - 28 118.00 -16.32
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26985381 8 COSMIC
COSN31495290 28 COSMIC
COSN30467898 38 COSMIC
COSN26985382 43 COSMIC
COSN30447540 57 COSMIC
COSN30472703 67 COSMIC
COSN23500720 77 COSMIC
COSN30459467 100 COSMIC
COSN30135021 111 COSMIC
COSN30144845 111 COSMIC
COSN18732208 127 COSMIC
COSN31577683 157 COSMIC
COSN31592477 185 COSMIC
COSN30104962 193 COSMIC
COSN20212085 300 COSMIC
COSN23279941 300 COSMIC
COSN30136084 301 COSMIC
COSN2188635 628 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs151258613 2 dbSNP
rs187135134 3 dbSNP
rs1454516779 8 dbSNP
rs73404820 9 dbSNP
rs1382925837 13 dbSNP
rs1407550055 21 dbSNP
rs1327225068 26 dbSNP
rs768859443 31 dbSNP
rs776325334 41 dbSNP
rs1225536714 42 dbSNP
rs373198651 43 dbSNP
rs374588011 44 dbSNP
rs1239344573 45 dbSNP
rs1293903388 46 dbSNP
rs1429835869 50 dbSNP
rs1259586733 51 dbSNP
rs1347973600 53 dbSNP
rs377319360 62 dbSNP
rs1457287187 72 dbSNP
rs1236933894 73 dbSNP
rs537994337 86 dbSNP
rs901467856 87 dbSNP
rs528041558 91 dbSNP
rs1009531903 95 dbSNP
rs4729654 97 dbSNP
rs1475331554 98 dbSNP
rs1335710836 102 dbSNP
rs1218619249 105 dbSNP
rs1465367406 107 dbSNP
rs1215725108 110 dbSNP
rs1201935382 112 dbSNP
rs1021644284 114 dbSNP
rs1338602698 124 dbSNP
rs4729655 127 dbSNP
rs1213737991 128 dbSNP
rs1196911308 129 dbSNP
rs1253263182 133 dbSNP
rs1420399613 149 dbSNP
rs1334136916 150 dbSNP
rs952437295 153 dbSNP
rs1470704243 155 dbSNP
rs1359379351 156 dbSNP
rs1005278327 157 dbSNP
rs1169359872 169 dbSNP
rs1409729251 177 dbSNP
rs1179045740 178 dbSNP
rs1191017965 188 dbSNP
rs979598830 193 dbSNP
rs1015175908 195 dbSNP
rs1181818506 200 dbSNP
rs926773317 203 dbSNP
rs1256784236 206 dbSNP
rs1204116278 207 dbSNP
rs1475331160 210 dbSNP
rs961036902 211 dbSNP
rs150528234 214 dbSNP
rs1228977842 221 dbSNP
rs1381928936 222 dbSNP
rs1312921019 223 dbSNP
rs1454089772 225 dbSNP
rs1379329287 226 dbSNP
rs553851030 231 dbSNP
rs573107763 234 dbSNP
rs917135877 237 dbSNP
rs1353055828 238 dbSNP
rs1398540006 245 dbSNP
rs917631424 247 dbSNP
rs1430867426 249 dbSNP
rs1389806079 250 dbSNP
rs939681823 252 dbSNP
rs540493073 265 dbSNP
rs1425579316 267 dbSNP
rs1036675071 268 dbSNP
rs1328287525 273 dbSNP
rs970028924 281 dbSNP
rs919868158 284 dbSNP
rs980312968 285 dbSNP
rs4729656 286 dbSNP
rs117451414 295 dbSNP
rs1053878980 300 dbSNP
rs1205606203 301 dbSNP
rs914020578 302 dbSNP
rs1040485360 306 dbSNP
rs945354525 307 dbSNP
rs1321757712 315 dbSNP
rs901904626 316 dbSNP
rs1041077682 319 dbSNP
rs138451649 325 dbSNP
rs932934220 326 dbSNP
rs746031829 328 dbSNP
rs968728378 334 dbSNP
rs1301791129 335 dbSNP
rs1459901396 336 dbSNP
rs113215808 343 dbSNP
rs1033841619 344 dbSNP
rs770007377 345 dbSNP
rs775846381 346 dbSNP
rs76767333 352 dbSNP
rs370692314 357 dbSNP
rs896932331 367 dbSNP
rs1014323709 377 dbSNP
rs992244786 379 dbSNP
rs1023986646 382 dbSNP
rs961143743 388 dbSNP
rs970355377 392 dbSNP
rs980044842 395 dbSNP
rs532819869 397 dbSNP
rs957182233 401 dbSNP
rs1189680414 403 dbSNP
rs1415182960 405 dbSNP
rs988680349 414 dbSNP
rs1318247587 416 dbSNP
rs1288531336 417 dbSNP
rs1222555968 423 dbSNP
rs913972511 434 dbSNP
rs919601060 437 dbSNP
rs1388944861 440 dbSNP
rs1392076790 446 dbSNP
rs551380551 453 dbSNP
rs1288838328 454 dbSNP
rs931259191 457 dbSNP
rs1390957150 458 dbSNP
rs530904614 461 dbSNP
rs1480237027 462 dbSNP
rs1374513688 465 dbSNP
rs977130559 466 dbSNP
rs1433629899 469 dbSNP
rs1260926480 480 dbSNP
rs772989105 491 dbSNP
rs1465826748 494 dbSNP
rs1297486642 501 dbSNP
rs1268211438 503 dbSNP
rs1202576744 505 dbSNP
rs566312621 513 dbSNP
rs1320952777 521 dbSNP
rs76925166 522 dbSNP
rs932858539 529 dbSNP
rs1050018901 531 dbSNP
rs1040871553 535 dbSNP
rs567619609 540 dbSNP
rs766223558 549 dbSNP
rs901952563 550 dbSNP
rs1355040360 560 dbSNP
rs776576328 561 dbSNP
rs888732288 563 dbSNP
rs1383188976 564 dbSNP
rs1298211249 570 dbSNP
rs941529929 571 dbSNP
rs549261043 572 dbSNP
rs1174579137 574 dbSNP
rs768735036 574 dbSNP
rs556602576 576 dbSNP
rs1372316298 579 dbSNP
rs1190850475 580 dbSNP
rs1281633907 581 dbSNP
rs759474729 582 dbSNP
rs896881318 585 dbSNP
rs1014021228 599 dbSNP
rs1024350848 606 dbSNP
rs1248629662 607 dbSNP
rs567557391 608 dbSNP
rs1459620908 611 dbSNP
rs1280268964 612 dbSNP
rs538031344 615 dbSNP
rs903844592 619 dbSNP
rs1346103966 622 dbSNP
rs1251112979 625 dbSNP
rs556409624 635 dbSNP
rs1000786179 640 dbSNP
rs369527683 661 dbSNP
rs1212388967 663 dbSNP
rs1344921298 668 dbSNP
rs1299084915 672 dbSNP
rs1451973482 674 dbSNP
rs1380698739 676 dbSNP
rs1255044654 677 dbSNP
rs1336353494 678 dbSNP
rs1482726991 681 dbSNP
rs1186688233 684 dbSNP
rs1033894077 685 dbSNP
rs764972517 688 dbSNP
rs1431467993 697 dbSNP
rs1013718269 704 dbSNP
rs1390676118 705 dbSNP
rs1162906881 710 dbSNP
rs1442187908 712 dbSNP
rs1238735119 718 dbSNP
rs1187731802 721 dbSNP
rs1436879256 727 dbSNP
rs867165337 728 dbSNP
rs55903219 734 dbSNP
rs1245922803 736 dbSNP
rs1354251129 756 dbSNP
rs1245686109 759 dbSNP
rs1395586323 759 dbSNP
rs1032923863 762 dbSNP
rs1306446816 762 dbSNP
rs957295313 771 dbSNP
rs972502435 779 dbSNP
rs57645356 795 dbSNP
rs1020145041 812 dbSNP
rs1374871757 814 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124A_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + A ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgacccgaaugcaacCCUCUUg 5'
                         |||||: 
Target 5' ---------gaaagaGGAGAGa 3'
 		1 - 13
Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_124A_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + A
Location of target site ENST00000306151.4 | 3UTR | GAAAGAGGAGAGACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE38974 Chronic obstructive pulmonary disease -0.505 5.0e-3 -0.646 2.4e-4 25 Click to see details
GSE19536 Breast cancer 0.203 2.1e-2 0.200 2.3e-2 100 Click to see details
GSE26953 Aortic valvular endothelial cells 0.405 2.5e-2 0.408 2.4e-2 24 Click to see details
GSE38226 Liver fibrosis -0.384 4.3e-2 -0.309 8.6e-2 21 Click to see details
GSE14794 Lymphoblastoid cells 0.173 5.1e-2 0.079 2.3e-1 90 Click to see details
GSE17306 Multiple myeloma 0.222 6.3e-2 0.264 3.3e-2 49 Click to see details
GSE19783 ER- ER- breast cancer 0.144 1.0e-1 0.039 3.7e-1 79 Click to see details
GSE21849 B cell lymphoma 0.174 1.8e-1 0.274 7.5e-2 29 Click to see details
GSE27834 Pluripotent stem cells 0.229 2.0e-1 0.235 1.9e-1 16 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.133 2.6e-1 0.382 3.0e-2 25 Click to see details
GSE28260 Renal cortex and medulla 0.124 3.4e-1 0.093 3.8e-1 13 Click to see details
GSE21032 Prostate cancer 0.038 3.7e-1 0.061 2.9e-1 83 Click to see details
GSE28544 Breast cancer 0.07 3.7e-1 -0.019 4.6e-1 24 Click to see details
GSE19350 CNS germ cell tumors -0.091 3.9e-1 -0.217 2.5e-1 12 Click to see details
GSE19783 ER+ ER+ breast cancer -0.065 3.9e-1 0.051 4.2e-1 20 Click to see details
GSE21687 Ependynoma primary tumors 0.02 4.4e-1 0.017 4.5e-1 64 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.029 4.5e-1 -0.269 1.3e-1 20 Click to see details
GSE32688 Pancreatic cancer -0.011 4.8e-1 0.007 4.8e-1 32 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.023 4.8e-1 0.117 3.8e-1 9 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUAD -0.749 0.01 -0.167 0.33 9 Click to see details
PAAD -0.937 0.03 -0.800 0.1 4 Click to see details
CHOL 0.627 0.04 0.650 0.03 9 Click to see details
UCEC 0.414 0.05 0.498 0.02 17 Click to see details
PRAD -0.236 0.06 -0.219 0.07 47 Click to see details
HNSC -0.22 0.08 -0.204 0.1 42 Click to see details
ESCA -0.426 0.1 -0.391 0.12 11 Click to see details
COAD 0.498 0.1 0.476 0.12 8 Click to see details
STAD 0.244 0.11 0.211 0.14 28 Click to see details
LIHC 0.174 0.12 0.210 0.08 48 Click to see details
KIRP 0.121 0.26 0.053 0.39 31 Click to see details
THCA -0.077 0.28 0.328 0.01 59 Click to see details
KIRC -0.045 0.36 0.065 0.3 66 Click to see details
KICH -0.056 0.4 0.322 0.06 25 Click to see details
LUSC 0.043 0.4 0.254 0.06 38 Click to see details
BLCA 0.019 0.47 0.280 0.17 14 Click to see details
BRCA -0.006 0.48 0.297 0 79 Click to see details
BRCA -0.006 0.48 0.297 0 79 Click to see details
BRCA -0.006 0.48 0.297 0 79 Click to see details
BRCA -0.006 0.48 0.297 0 79 Click to see details
BRCA -0.006 0.48 0.297 0 79 Click to see details
191 hsa-miR-629-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT039582 DDX3X DEAD-box helicase 3, X-linked 1 1
MIRT039583 ATP5B ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide 1 1
MIRT069646 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT069658 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT078218 DYNLL2 dynein light chain LC8-type 2 2 2
MIRT082346 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 2 2
MIRT107793 SLC1A1 solute carrier family 1 member 1 2 2
MIRT161354 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT228097 BNC2 basonuclin 2 2 2
MIRT312967 STC2 stanniocalcin 2 2 2
MIRT338797 STMN1 stathmin 1 2 2
MIRT454524 RABL2A RAB, member of RAS oncogene family like 2A 2 2
MIRT457233 RABL2B RAB, member of RAS oncogene family like 2B 2 2
MIRT461303 MRPS27 mitochondrial ribosomal protein S27 2 2
MIRT463194 ZNF148 zinc finger protein 148 2 4
MIRT477013 FAM217B family with sequence similarity 217 member B 2 2
MIRT484037 CMKLR1 chemerin chemokine-like receptor 1 2 6
MIRT489367 RAB11B RAB11B, member RAS oncogene family 2 2
MIRT493927 FAM127A retrotransposon Gag like 8C 2 4
MIRT494841 RPAP2 RNA polymerase II associated protein 2 2 2
MIRT494970 TMEM233 transmembrane protein 233 2 2
MIRT496633 SLC46A1 solute carrier family 46 member 1 2 2
MIRT498517 ZNF83 zinc finger protein 83 2 8
MIRT499461 ZNF669 zinc finger protein 669 2 8
MIRT500254 ZNF791 zinc finger protein 791 2 6
MIRT500271 ZNF781 zinc finger protein 781 2 8
MIRT500327 ZNF487P zinc finger protein 487 1 3
MIRT502556 EBAG9 estrogen receptor binding site associated, antigen, 9 2 2
MIRT503658 ZNF138 zinc finger protein 138 2 6
MIRT504010 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT504592 ZNF440 zinc finger protein 440 2 4
MIRT504827 EREG epiregulin 2 2
MIRT513587 DCTN6 dynactin subunit 6 2 2
MIRT515145 ZNF732 zinc finger protein 732 2 8
MIRT519375 FKBP14 FK506 binding protein 14 2 2
MIRT519635 ZNF772 zinc finger protein 772 2 4
MIRT525273 C18orf32 chromosome 18 open reading frame 32 2 2
MIRT525446 GPATCH2L G-patch domain containing 2 like 2 2
MIRT526165 ANKRD65 ankyrin repeat domain 65 2 2
MIRT526580 CCDC43 coiled-coil domain containing 43 2 2
MIRT528010 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT528140 LRRC38 leucine rich repeat containing 38 2 2
MIRT528641 NEURL neuralized E3 ubiquitin protein ligase 1 1 1
MIRT529290 AGK acylglycerol kinase 2 2
MIRT532739 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT534299 SKIDA1 SKI/DACH domain containing 1 2 2
MIRT534335 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT537952 DSE dermatan sulfate epimerase 2 2
MIRT538789 C3orf52 chromosome 3 open reading frame 52 2 2
MIRT544379 ZNF266 zinc finger protein 266 2 2
MIRT544450 KRBOX4 KRAB box domain containing 4 2 2
MIRT545375 PM20D2 peptidase M20 domain containing 2 2 2
MIRT548154 FRAT2 FRAT2, WNT signaling pathway regulator 2 2
MIRT552477 ZNF202 zinc finger protein 202 2 2
MIRT557714 GABARAPL1 GABA type A receptor associated protein like 1 2 2
MIRT558897 CCDC58 coiled-coil domain containing 58 2 2
MIRT562727 ZNF468 zinc finger protein 468 2 2
MIRT563640 ZNF675 zinc finger protein 675 2 2
MIRT563672 ZNF254 zinc finger protein 254 2 2
MIRT563682 RPS26 ribosomal protein S26 2 2
MIRT563722 ZNF107 zinc finger protein 107 2 2
MIRT563947 ZNF431 zinc finger protein 431 2 4
MIRT565266 TNRC6C trinucleotide repeat containing 6C 2 2
MIRT566218 PTMA prothymosin, alpha 2 4
MIRT568330 BACH1 BTB domain and CNC homolog 1 2 2
MIRT570862 ZNF525 zinc finger protein 525 2 2
MIRT570871 ZFP1 ZFP1 zinc finger protein 2 2
MIRT571513 ZNF625 zinc finger protein 625 2 2
MIRT572286 ZNF584 zinc finger protein 584 2 2
MIRT572896 RUNDC3B RUN domain containing 3B 2 2
MIRT573083 APLN apelin 2 2
MIRT611739 SERPING1 serpin family G member 1 2 4
MIRT612667 POU2F1 POU class 2 homeobox 1 2 4
MIRT612738 MYOCD myocardin 2 2
MIRT614005 PAOX polyamine oxidase 2 2
MIRT616522 URM1 ubiquitin related modifier 1 2 2
MIRT617811 EMX2 empty spiracles homeobox 2 2 2
MIRT618630 COL4A3BP collagen type IV alpha 3 binding protein 2 2
MIRT619753 MYO1F myosin IF 2 2
MIRT619971 ZSCAN22 zinc finger and SCAN domain containing 22 2 2
MIRT621350 GUCA1B guanylate cyclase activator 1B 2 2
MIRT621379 CLNK cytokine dependent hematopoietic cell linker 2 2
MIRT621510 ZNF638 zinc finger protein 638 2 2
MIRT621536 ZNF500 zinc finger protein 500 2 2
MIRT621616 UHRF1BP1L UHRF1 binding protein 1 like 2 2
MIRT621771 TMEM87B transmembrane protein 87B 2 2
MIRT623498 KCNQ3 potassium voltage-gated channel subfamily Q member 3 2 2
MIRT624079 DR1 down-regulator of transcription 1 2 2
MIRT627001 LINC00598 long intergenic non-protein coding RNA 598 2 4
MIRT628435 ANTXR2 anthrax toxin receptor 2 2 2
MIRT635439 SLC25A44 solute carrier family 25 member 44 2 2
MIRT637161 TMEM50A transmembrane protein 50A 2 2
MIRT638482 OTUB2 OTU deubiquitinase, ubiquitin aldehyde binding 2 2 4
MIRT639287 TFAP2A transcription factor AP-2 alpha 2 4
MIRT639395 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT641046 PTPRB protein tyrosine phosphatase, receptor type B 2 2
MIRT642576 PSTPIP1 proline-serine-threonine phosphatase interacting protein 1 2 2
MIRT644206 CBS cystathionine-beta-synthase 2 2
MIRT645321 GPR158 G protein-coupled receptor 158 2 2
MIRT645682 TBC1D13 TBC1 domain family member 13 2 2
MIRT646633 COA4 cytochrome c oxidase assembly factor 4 homolog 2 2
MIRT647269 AADACL3 arylacetamide deacetylase like 3 2 2
MIRT648384 ZNF22 zinc finger protein 22 2 2
MIRT648626 LEMD2 LEM domain containing 2 2 2
MIRT650077 MTL5 testis expressed metallothionein like protein 2 2
MIRT650138 ZNF426 zinc finger protein 426 2 2
MIRT650240 CD68 CD68 molecule 2 2
MIRT650836 SEMA4G semaphorin 4G 2 2
MIRT651100 ZNF48 zinc finger protein 48 2 2
MIRT651128 ZNF398 zinc finger protein 398 2 4
MIRT651638 WASF2 WAS protein family member 2 2 2
MIRT652315 TNPO3 transportin 3 2 2
MIRT652753 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT653200 SP9 Sp9 transcription factor 2 2
MIRT653388 SLIT1 slit guidance ligand 1 2 2
MIRT653714 SLC25A32 solute carrier family 25 member 32 2 2
MIRT654498 RABIF RAB interacting factor 2 2
MIRT654811 PPP3R1 protein phosphatase 3 regulatory subunit B, alpha 2 2
MIRT655161 PHF20L1 PHD finger protein 20 like 1 2 2
MIRT655426 PALM2-AKAP2 PALM2-AKAP2 readthrough 2 2
MIRT655538 PADI2 peptidyl arginine deiminase 2 2 4
MIRT656247 MEX3A mex-3 RNA binding family member A 2 2
MIRT656377 MCU mitochondrial calcium uniporter 2 2
MIRT656579 LSAMP limbic system-associated membrane protein 2 2
MIRT656871 KIF26B kinesin family member 26B 2 2
MIRT656972 KDM5B lysine demethylase 5B 2 2
MIRT657211 IGF1R insulin like growth factor 1 receptor 2 2
MIRT657822 GJD3 gap junction protein delta 3 2 2
MIRT658427 FAM175B abraxas 2, BRISC complex subunit 2 2
MIRT658462 FAM102B family with sequence similarity 102 member B 2 2
MIRT658638 ENAH ENAH, actin regulator 2 2
MIRT660047 C12orf5 TP53 induced glycolysis regulatory phosphatase 1 1
MIRT660418 ATXN1L ataxin 1 like 2 2
MIRT660625 ANKRD52 ankyrin repeat domain 52 2 2
MIRT660771 AKAP2 A-kinase anchoring protein 2 2 2
MIRT660978 ABHD2 abhydrolase domain containing 2 2 2
MIRT660999 ABHD10 abhydrolase domain containing 10 2 2
MIRT662146 IPO11 importin 11 2 2
MIRT662558 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT663289 TECPR2 tectonin beta-propeller repeat containing 2 2 2
MIRT663809 RNF128 ring finger protein 128, E3 ubiquitin protein ligase 2 2
MIRT663820 NLRP12 NLR family pyrin domain containing 12 2 2
MIRT666963 PITPNM3 PITPNM family member 3 2 2
MIRT668239 FZD2 frizzled class receptor 2 2 2
MIRT669328 BSND barttin CLCNK type accessory beta subunit 2 2
MIRT679289 SSBP2 single stranded DNA binding protein 2 2 2
MIRT687506 NCKAP1 NCK associated protein 1 2 2
MIRT697018 EPDR1 ependymin related 1 2 2
MIRT698929 SPATA2 spermatogenesis associated 2 2 2
MIRT700850 PERP PERP, TP53 apoptosis effector 2 2
MIRT702425 KIAA1958 KIAA1958 2 2
MIRT703937 EPB41L1 erythrocyte membrane protein band 4.1 like 1 2 2
MIRT705374 ATP1B3 ATPase Na+/K+ transporting subunit beta 3 2 2
MIRT708308 CDH8 cadherin 8 2 2
MIRT708644 LYRM7 LYR motif containing 7 2 2
MIRT708960 SLC12A3 solute carrier family 12 member 3 2 2
MIRT709460 KRTAP19-1 keratin associated protein 19-1 2 2
MIRT709944 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT710089 FAM229B family with sequence similarity 229 member B 2 2
MIRT711120 CYYR1 cysteine and tyrosine rich 1 2 2
MIRT711553 FAM20B FAM20B, glycosaminoglycan xylosylkinase 2 2
MIRT711575 ASPA aspartoacylase 2 2
MIRT712231 RCC2 regulator of chromosome condensation 2 2 2
MIRT712401 MGAT5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase 2 2
MIRT713193 WNK2 WNK lysine deficient protein kinase 2 2 2
MIRT713316 TMEM44 transmembrane protein 44 2 2
MIRT713508 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT713615 MED8 mediator complex subunit 8 2 2
MIRT713956 BCL2L13 BCL2 like 13 2 2
MIRT714347 CES2 carboxylesterase 2 2 2
MIRT714987 TSPAN11 tetraspanin 11 2 2
MIRT715165 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT715433 RGS6 regulator of G protein signaling 6 2 2
MIRT715465 NEGR1 neuronal growth regulator 1 2 2
MIRT715886 GNG2 G protein subunit gamma 2 2 2
MIRT716089 HARS histidyl-tRNA synthetase 2 2
MIRT717379 RBM41 RNA binding motif protein 41 2 2
MIRT717395 ZCCHC24 zinc finger CCHC-type containing 24 2 2
MIRT717964 PXMP4 peroxisomal membrane protein 4 2 2
MIRT719212 CAMK4 calcium/calmodulin dependent protein kinase IV 2 2
MIRT720580 FAM9C family with sequence similarity 9 member C 2 2
MIRT720712 RAPGEF6 Rap guanine nucleotide exchange factor 6 2 2
MIRT721069 TGFBI transforming growth factor beta induced 2 2
MIRT721326 IFNAR2 interferon alpha and beta receptor subunit 2 2 2
MIRT721473 BTN3A2 butyrophilin subfamily 3 member A2 2 2
MIRT721734 SDK2 sidekick cell adhesion molecule 2 2 2
MIRT723545 ZDHHC22 zinc finger DHHC-type containing 22 2 2
MIRT723745 AIFM2 apoptosis inducing factor, mitochondria associated 2 2 2
MIRT723787 MUC17 mucin 17, cell surface associated 2 2
MIRT725499 GANAB glucosidase II alpha subunit 2 2
MIRT735726 FOXO3 forkhead box O3 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-629 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-629 Ascorbate approved 54670067 Microarray Metastatic melanoma cell lines 25202679 2014 up-regualted
miR-629 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-629 Sorafenib approved 216239 Quantitative real-time PCR hepatocellular carcinoma 21530512 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-629 Paroxetine 43815 approved sensitive High Normal lymphoblastoid cell line
hsa-mir-629 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-629 Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-629 Verapamil 2520 NSC272366 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-629 Daunorubicin 30323 NSC82151 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-629 Vincristine 5978 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-629 L-Asparaginase resistant High Lymphoblastic Leukemia tissue
hsa-miR-629 Prednisolone 5755 NSC9120 approved resistant High Lymphoblastic Leukemia tissue
hsa-miR-629 Paroxetine 43815 approved resistant High Normal lymphoblastoid cell line
hsa-miR-629 Sunitinib 5329102 NSC750690 approved sensitive High Renal Cell Cancer tissue
hsa-miR-629 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-629 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-629 Cisplatin 5460033 NSC119875 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-629 1'-Acetoxychavicol acetate 119104 NSC711510 resistant Low Cervical Cancer cell line (Ca Ski, SiHa)
hsa-miR-629 Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-629 Sunitinib 5329102 NSC750690 approved sensitive High Renal Cell Cancer tissue
hsa-mir-629 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-629 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-629 Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-mir-629 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-629 Cisplatin 5460033 NSC119875 approved resistant cell line (KYSE)
hsa-mir-629 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-629 Paclitaxel 36314 NSC125973 approved resistant cell line (HeyA8)
hsa-miR-629 Testosterone+Exemestane sensitive cell line (MCF-7)
hsa-miR-629 Testosterone+Tamoxifen sensitive cell line (MCF-7)
hsa-miR-629 Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-629 Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-629 Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-629 Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-629 Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-629 Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-629 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-629 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-629 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)
hsa-miR-629 Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)
hsa-miR-629 Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)
hsa-miR-629 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-629-3p Paroxetine 43815 approved resistant High Normal lymphoblastoid cell line
hsa-miR-629-3p Chemotherapy sensitive High Epithelial Ovarian Cancer tissue
hsa-miR-629-3p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375)
hsa-miR-629-3p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (TAMR4)
hsa-miR-629-3p Cisplatin 5460033 NSC119875 approved resistant High Gallbladder Cancer cell line (GBC-SD, NOZ)
hsa-miR-629-3p Ponatinib 24826799 NSC758487 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-629-3p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-629-3p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-629-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HCT-116)
hsa-miR-629-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-629-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (SW480, HCT-116)
hsa-miR-629-3p Rituximab sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-629-3p Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, HSC-3, HSC-4)
hsa-miR-629-3p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-629-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-629-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-629-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (mitochondrial RNA)
hsa-miR-629-3p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-629-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-629-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-629-3p Leuprorelin/Goserelin + Bicalutamide sensitive tissue (prostate cancer)
hsa-miR-629-3p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-629-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-629-3p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-629-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-629-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-629-3p Gemcitabine 60750 NSC613327 approved resistant cell line (MDA-231)
hsa-miR-629-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-629-3p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-629-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H460)
hsa-miR-629-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVCAR3)
hsa-miR-629-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (H23)

Error report submission