pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-374b |
Genomic Coordinates | chrX: 103573060 - 103573154 |
Description | Mus musculus miR-374b stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-374b-5p |
Sequence | 22| AUAUAAUACAACCUGCUAAGUG |43 |
Evidence | Experimental |
Experiments | Cloned |
Putative Targets |
Gene Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | Myf6 | |||||||||||||||
Synonyms | MRF4, bHLHc4, herculin | |||||||||||||||
Description | myogenic factor 6 | |||||||||||||||
Transcript | NM_008657 | |||||||||||||||
Expression | ||||||||||||||||
Putative miRNA Targets on Myf6 | ||||||||||||||||
3'UTR of Myf6 (miRNA target sites are highlighted) |
>Myf6|NM_008657|3'UTR 1 CTCAGCCAGCATTTGGAACATTCTTCACCCAGCAGGAAGACCCCCCTTTCCACCTAATCATTTAGATTAGGGCTCACAGA 81 TGCCAGCTTTTATGAAAGGCGAGAGATTTAGTATTTAAAAAGAAACTTCTCACCACCTCAAGTGAAAGTCCTTCGCCTTG 161 GGGCTTTTATTATGATACTTATTATTATATCGGAACGGCTAGTAGCTTAGCTCTAGAACCCTGATTTTGTTTTTAGTTTG 241 GTTGGTTTTAATAACATATTAACTTTTACTATGATCACGTGACCCTTTTTTGTCAGTTGCAAACGAAGTTCATTCCTGTC 321 TAAATCAAAGAGAGAACGTTTAATCCTAATAGTATATAATGTACTTTTTGTAAATAGTCTTAGAACTTTCGTTTCTATGT 401 AAACCTAAAGAATATATTTTAAACGTGGATTTAACATTGTATATAAAATGTGTGAAGATCCTGATATTGTAATATTAAAA 481 TATTAATACGTTTC Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
|||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | C2C12 , HeLa |
Location of target site | 3'UTR |
Tools used in this research | miRanda |
Original Description (Extracted from the article) |
...
We showed that miR-374b speci茂卢聛cally bound to the 3'untranslated region (UTR) of Myf6 and down-regulated the expression of Myf6 gene at both mRNA and protein level.
... - Ma Z; Sun X; Xu D; Xiong Y; Zuo B, 2015, Biochemical and biophysical research communications. |
Article |
- Ma Z; Sun X; Xu D; Xiong Y; Zuo B - Biochemical and biophysical research communications, 2015
Myogenesis is a complex process including myoblast proliferation, differentiation and myotube formation and is controlled by myogenic regulatory factors (MRFs), MyoD, MyoG, Myf5 and Myf6 (also known as MRF4). MicroRNA is a kind of approximately 22 nt-long non-coding small RNAs, and act as key transcriptional or post-transcriptional regulators of gene expression. Identification of miRNAs involved in the regulation of muscle genes could improve our understanding of myogenesis process. In this study, we investigated the regulation of Myf6 gene by miRNAs. We showed that miR-374b specifically bound to the 3'untranslated region (UTR) of Myf6 and down-regulated the expression of Myf6 gene at both mRNA and protein level. Furthermore, miR-374b is ubiquitously expressed in the tissues of adult C57BL6 mouse, and the mRNA abundance increases first and then decreases during C2C12 myoblasts differentiation. Over-expression of miR-374b impaired C2C12 cell differentiation, while inhibiting miR-374b expression by 2'-O-methyl antisense oligonucleotides promoted C2C12 cell differentiation. Taken together, our findings identified miR-374b directly targets Myf6 and negatively regulates myogenesis.
LinkOut: [PMID: 26498529]
|
76 mmu-miR-374b-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT418787 | Map2 | microtubule-associated protein 2 | ![]() |
1 | 1 | |||||||
MIRT577252 | Zfp84 | zinc finger protein 84 | ![]() |
1 | 1 | |||||||
MIRT577346 | Zfp11 | zinc finger protein 11 | ![]() |
1 | 1 | |||||||
MIRT577582 | Tcf21 | transcription factor 21 | ![]() |
1 | 1 | |||||||
MIRT577695 | Slc35d2 | solute carrier family 35, member D2 | ![]() |
1 | 1 | |||||||
MIRT577869 | Rassf5 | Ras association (RalGDS/AF-6) domain family member 5 | ![]() |
1 | 1 | |||||||
MIRT577940 | Ppp6r1 | protein phosphatase 6, regulatory subunit 1 | ![]() |
1 | 1 | |||||||
MIRT577949 | Pou4f2 | POU domain, class 4, transcription factor 2 | ![]() |
1 | 1 | |||||||
MIRT578202 | Nadsyn1 | NAD synthetase 1 | ![]() |
1 | 1 | |||||||
MIRT578468 | Impg2 | interphotoreceptor matrix proteoglycan 2 | ![]() |
1 | 1 | |||||||
MIRT578587 | Hist1h1d | histone cluster 1, H1d | ![]() |
1 | 1 | |||||||
MIRT579056 | Cradd | CASP2 and RIPK1 domain containing adaptor with death domain | ![]() |
1 | 1 | |||||||
MIRT579823 | Zfp113 | zinc finger protein 113 | ![]() |
1 | 2 | |||||||
MIRT579840 | Zer1 | zyg-11 related, cell cycle regulator | ![]() |
1 | 1 | |||||||
MIRT579950 | Xpo7 | exportin 7 | ![]() |
1 | 1 | |||||||
MIRT579992 | Wnt3 | wingless-type MMTV integration site family, member 3 | ![]() |
1 | 1 | |||||||
MIRT579997 | Wnt11 | wingless-type MMTV integration site family, member 11 | ![]() |
1 | 1 | |||||||
MIRT580191 | Ttll7 | tubulin tyrosine ligase-like family, member 7 | ![]() |
1 | 1 | |||||||
MIRT580256 | Trim2 | tripartite motif-containing 2 | ![]() |
1 | 1 | |||||||
MIRT580383 | Tmem206 | transmembrane protein 206 | ![]() |
1 | 2 | |||||||
MIRT580415 | Tmem161b | transmembrane protein 161B | ![]() |
1 | 1 | |||||||
MIRT580534 | Tead3 | TEA domain family member 3 | ![]() |
1 | 1 | |||||||
MIRT580565 | Tbx4 | T-box 4 | ![]() |
1 | 1 | |||||||
MIRT580611 | Syp | synaptophysin | ![]() |
1 | 1 | |||||||
MIRT581171 | Sec23ip | Sec23 interacting protein | ![]() |
1 | 1 | |||||||
MIRT581538 | Pten | phosphatase and tensin homolog | ![]() |
1 | 1 | |||||||
MIRT581571 | Prrx1 | paired related homeobox 1 | ![]() |
1 | 1 | |||||||
MIRT581741 | Plxnc1 | plexin C1 | ![]() |
1 | 1 | |||||||
MIRT581794 | Plaur | plasminogen activator, urokinase receptor | ![]() |
1 | 1 | |||||||
MIRT581822 | Pkib | protein kinase inhibitor beta, cAMP dependent, testis specific | ![]() |
1 | 1 | |||||||
MIRT581971 | Pdcd10 | programmed cell death 10 | ![]() |
1 | 1 | |||||||
MIRT582055 | Osbp | oxysterol binding protein | ![]() |
1 | 1 | |||||||
MIRT582142 | Npr3 | natriuretic peptide receptor 3 | ![]() |
1 | 1 | |||||||
MIRT582168 | Nkx2-2 | NK2 homeobox 2 | ![]() |
1 | 1 | |||||||
MIRT582469 | Mex3a | mex3 RNA binding family member A | ![]() |
1 | 1 | |||||||
MIRT582518 | March5 | membrane-associated ring finger (C3HC4) 5 | ![]() |
1 | 2 | |||||||
MIRT582589 | Lrrtm2 | leucine rich repeat transmembrane neuronal 2 | ![]() |
1 | 1 | |||||||
MIRT582667 | Lmtk2 | lemur tyrosine kinase 2 | ![]() |
1 | 1 | |||||||
MIRT583063 | Hoxa11 | homeobox A11 | ![]() |
1 | 1 | |||||||
MIRT583111 | Hexim1 | hexamethylene bis-acetamide inducible 1 | ![]() |
1 | 1 | |||||||
MIRT583233 | Gpc6 | glypican 6 | ![]() |
1 | 1 | |||||||
MIRT583395 | Fzd5 | frizzled class receptor 5 | ![]() |
1 | 1 | |||||||
MIRT583429 | Frmpd4 | FERM and PDZ domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT583613 | Fam46a | family with sequence similarity 46, member A | ![]() |
1 | 1 | |||||||
MIRT583848 | Eea1 | early endosome antigen 1 | ![]() |
1 | 1 | |||||||
MIRT584669 | B3gat1 | beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) | ![]() |
1 | 1 | |||||||
MIRT584731 | Atp2b2 | ATPase, Ca++ transporting, plasma membrane 2 | ![]() |
1 | 1 | |||||||
MIRT584872 | Ap3m1 | adaptor-related protein complex 3, mu 1 subunit | ![]() |
1 | 1 | |||||||
MIRT585039 | Lrrc71 | leucine rich repeat containing 71 | ![]() |
1 | 1 | |||||||
MIRT585303 | Zfp248 | zinc finger protein 248 | ![]() |
1 | 3 | |||||||
MIRT585725 | T2 | brachyury 2 | ![]() |
1 | 1 | |||||||
MIRT585759 | St8sia3 | ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 | ![]() |
1 | 1 | |||||||
MIRT585986 | Sfxn4 | sideroflexin 4 | ![]() |
1 | 1 | |||||||
MIRT586181 | Ptprr | protein tyrosine phosphatase, receptor type, R | ![]() |
1 | 1 | |||||||
MIRT586738 | Lcn5 | lipocalin 5 | ![]() |
1 | 1 | |||||||
MIRT586778 | Jmjd4 | jumonji domain containing 4 | ![]() |
1 | 1 | |||||||
MIRT587048 | Gm5531 | transmembrane epididymal protein 1B | ![]() |
1 | 1 | |||||||
MIRT587444 | Dimt1 | DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) | ![]() |
1 | 1 | |||||||
MIRT588190 | A130010J15Rik | RIKEN cDNA A130010J15 gene | ![]() |
1 | 1 | |||||||
MIRT588690 | Tet2 | tet methylcytosine dioxygenase 2 | ![]() |
1 | 1 | |||||||
MIRT589450 | Nck2 | non-catalytic region of tyrosine kinase adaptor protein 2 | ![]() |
1 | 1 | |||||||
MIRT590325 | Csgalnact2 | chondroitin sulfate N-acetylgalactosaminyltransferase 2 | ![]() |
1 | 1 | |||||||
MIRT590458 | Car5b | carbonic anhydrase 5b, mitochondrial | ![]() |
1 | 1 | |||||||
MIRT590752 | Actr10 | ARP10 actin-related protein 10 | ![]() |
1 | 1 | |||||||
MIRT594398 | Ints6 | integrator complex subunit 6 | ![]() |
1 | 1 | |||||||
MIRT594639 | Mex3c | mex3 RNA binding family member C | ![]() |
![]() |
2 | 1 | ||||||
MIRT594870 | Man1a2 | mannosidase, alpha, class 1A, member 2 | ![]() |
1 | 1 | |||||||
MIRT595871 | Csmd1 | CUB and Sushi multiple domains 1 | ![]() |
1 | 1 | |||||||
MIRT596012 | Ceacam1 | carcinoembryonic antigen-related cell adhesion molecule 1 | ![]() |
1 | 1 | |||||||
MIRT596332 | Rpp14 | ribonuclease P 14 subunit | ![]() |
1 | 1 | |||||||
MIRT600146 | Zfp1 | zinc finger protein 1 | ![]() |
1 | 1 | |||||||
MIRT601141 | Bcl11b | B cell leukemia/lymphoma 11B | ![]() |
1 | 1 | |||||||
MIRT601571 | Sumf2 | sulfatase modifying factor 2 | ![]() |
1 | 1 | |||||||
MIRT605724 | Gmeb1 | glucocorticoid modulatory element binding protein 1 | ![]() |
1 | 1 | |||||||
MIRT731705 | Myf6 | myogenic factor 6 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT735635 | Socs1 | suppressor of cytokine signaling 1 | ![]() |
![]() |
![]() |
3 | 0 |
miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|