pre-miRNA Information | |
---|---|
pre-miRNA | mmu-mir-351 |
Genomic Coordinates | chrX: 53053255 - 53053353 |
Synonyms | Mirn351, mmu-mir-351, Mir351 |
Description | Mus musculus miR-351 stem-loop |
Comment | The predominant miRNA cloned by Langraf et al. has a 3' terminal U residue, which is incompatible with the genome sequence . |
RNA Secondary Structure |
Mature miRNA Information | |
---|---|
Mature miRNA | mmu-miR-351-5p |
Sequence | 16| UCCCUGAGGAGCCCUUUGAGCCUG |39 |
Evidence | Experimental |
Experiments | Cloned |
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | F8 | ||||||||||||||||||||
Synonyms | Cf-8, Cf8, FVIII | ||||||||||||||||||||
Description | coagulation factor VIII | ||||||||||||||||||||
Transcript | NM_001161373 | ||||||||||||||||||||
Other Transcripts | NM_001161374 , NM_007977 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on F8 | |||||||||||||||||||||
3'UTR of F8 (miRNA target sites are highlighted) |
>F8|NM_001161373|3'UTR
1 GGTAGCCTCTGCATCACCTGCTTATTCCCCTTCCTCAGCTCAAAGATTGTCTTAATGTTTTAT TGCTGTGAAGAGACACT
81 ATGACCATGGCAACTCTTATAAAATAAAGCATTTAATCAGGGCTTACTTATAGTTTAAAAAAAAAAAAAAAAA
Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
22 mmu-miR-351-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT005493 | Tnf | tumor necrosis factor | 3 | 1 | ||||||||
MIRT005494 | Siah2 | seven in absentia 2 | 3 | 1 | ||||||||
MIRT054029 | E2f3 | E2F transcription factor 3 | 4 | 1 | ||||||||
MIRT580229 | Tspan12 | tetraspanin 12 | 1 | 1 | ||||||||
MIRT580251 | Trim71 | tripartite motif-containing 71 | 1 | 1 | ||||||||
MIRT582369 | Mtf1 | metal response element binding transcription factor 1 | 1 | 1 | ||||||||
MIRT582453 | Mgat4a | mannoside acetylglucosaminyltransferase 4, isoenzyme A | 1 | 1 | ||||||||
MIRT584883 | Antxr2 | anthrax toxin receptor 2 | 1 | 1 | ||||||||
MIRT587194 | Foxk1 | forkhead box K1 | 1 | 1 | ||||||||
MIRT588849 | Snrnp40 | small nuclear ribonucleoprotein 40 (U5) | 1 | 1 | ||||||||
MIRT591277 | Lars2 | leucyl-tRNA synthetase, mitochondrial | 1 | 2 | ||||||||
MIRT592913 | Madd | MAP-kinase activating death domain | 1 | 1 | ||||||||
MIRT594892 | Il1rn | interleukin 1 receptor antagonist | 1 | 2 | ||||||||
MIRT596428 | Hif1an | hypoxia-inducible factor 1, alpha subunit inhibitor | 1 | 1 | ||||||||
MIRT599144 | Dqx1 | DEAQ RNA-dependent ATPase | 1 | 1 | ||||||||
MIRT599715 | Aph1c | aph1 homolog C, gamma secretase subunit | 1 | 1 | ||||||||
MIRT600831 | Gm14137 | predicted gene 14137 | 1 | 1 | ||||||||
MIRT604900 | Jmy | junction-mediating and regulatory protein | 1 | 1 | ||||||||
MIRT605442 | Stat1 | signal transducer and activator of transcription 1 | 1 | 1 | ||||||||
MIRT606093 | Wdr25 | WD repeat domain 25 | 1 | 1 | ||||||||
MIRT732643 | F8 | coagulation factor VIII | 3 | 0 | ||||||||
MIRT734828 | Sox11 | SRY (sex determining region Y)-box 11 | 2 | 0 |
miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|