pre-miRNA Information
pre-miRNA mmu-mir-130a   
Genomic Coordinates chr2: 84741115 - 84741178
Description Mus musculus miR-130a stem-loop
Comment This sequence was named miR-130 in reference , but is renamed here to avoid confusion with miR-130b (MIR:MI0000408).
RNA Secondary Structure

Mature miRNA Information
Mature miRNA mmu-miR-130a-3p
Sequence 42| CAGUGCAAUGUUAAAAGGGCAU |63
Evidence Experimental
Experiments Cloned
Putative Targets

Gene Information
Gene Symbol Il12b
21 mmu-miR-130a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT003777 Atxn1 ataxin 1 2 1
MIRT003840 Zfpm2 zinc finger protein, multitype 2 3 1
MIRT015618 Meox2 mesenchyme homeobox 2 2 1
MIRT580135 Ubap2l ubiquitin-associated protein 2-like 1 1
MIRT580368 Tmem25 transmembrane protein 25 1 1
MIRT580806 Snx27 sorting nexin family member 27 1 1
MIRT582792 Kdm2a lysine (K)-specific demethylase 2A 1 1
MIRT590621 Arrdc3 arrestin domain containing 3 1 1
MIRT590766 Acbd5 acyl-Coenzyme A binding domain containing 5 1 1
MIRT592548 Mup7 major urinary protein 7 1 1
MIRT592589 Mup13 major urinary protein 13 1 1
MIRT594101 Nfia nuclear factor I/A 1 1
MIRT595107 Timp2 tissue inhibitor of metalloproteinase 2 1 1
MIRT595359 Fgfr1op2 FGFR1 oncogene partner 2 1 1
MIRT600786 Homez homeodomain leucine zipper-encoding gene 1 1
MIRT604875 Map3k12 mitogen-activated protein kinase kinase kinase 12 1 1
MIRT606374 Inpp5e inositol polyphosphate-5-phosphatase E 1 1
MIRT732598 ATG16L1 autophagy related 16 like 1 4 0
MIRT734762 Il12b interleukin 12b 2 0
MIRT734763 Irf1 interferon regulatory factor 1 2 0
MIRT755991 Trim37 tripartite motif-containing 37 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-130a N-ethyl-N-nitrosourea NULL 12967 Quantitative real-time PCR mouse liver 21029445 2010 up-regulated
miR-130a Reversine NULL 210332 Quantitative real-time PCR C2C12 myoblast cells 24513286 2014 down-regulated
miR-130a Benzene NULL 241 MiRNA PCR array white blood cell 24780745 2014 down-regulated
miR-130a Benzene NULL 241 MiRNA PCR array blood mononuclear cells 24780745 2014 down-regulated
miR-130a Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-130a 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-130a 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-130a Progesterone approved 5994 Microarray Breast cancer 22330642 2012 down-regulated
miR-130a Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated

Error report submission